Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38700
Trapped Gene
Mapkapk5 (ENSMUSG00000029454)
Vector Insertion
Chr 5: 121985862 - 121987230
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189011 (Chr5:121987121..121987229 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAAGGGGGAGAGCTATTT Chr5:121987181..121987200 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189011 (Chr5:121987121..121987229 -)
Downstram Exon
ENSMUSE00000189013 (Chr5:121985863..121985952 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAAGGGGGAGAGCTATTT Chr5:121987181..121987200 60.03 50 CTCTGTGCGCAATGTTTAGC Chr5:121985882..121985901 59.64 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000413309 Chr5:121995174..121995901 GACAGCGACATGGAGAAAGC Chr5:121995181..121995200 60.96 55
upstream ENSMUSE00000688995 Chr5:121995174..121995209 GACAGCGACATGGAGAAAGC Chr5:121995181..121995200 60.96 55
upstream ENSMUSE00000189014 Chr5:121990511..121990584 AACTGGGAGCCGGAATTAGT Chr5:121990522..121990541 59.96 50
upstream ENSMUSE00000282833 Chr5:121989181..121989256 CACTCAAGAACGGTTTGCAC Chr5:121989219..121989238 59.34 50
upstream ENSMUSE00000282826 Chr5:121988402..121988499 CCACACACCCCAACATAGTTC Chr5:121988457..121988477 60.14 52.38
upstream ENSMUSE00000688988 Chr5:121987662..121987730 CTCCCTTGCACTCAGAACCT Chr5:121987679..121987698 59.45 55
upstream ENSMUSE00000189011 Chr5:121987121..121987229 TGGAAGGGGGAGAGCTATTT Chr5:121987181..121987200 60.03 50
upstream ENSMUSE00000688987 Chr5:121987121..121987229 TGGAAGGGGGAGAGCTATTT Chr5:121987181..121987200 60.03 50
upstream ENSMUSE00000189013 Chr5:121985863..121985952 GCTAAACATTGCGCACAGAG Chr5:121985904..121985923 59.64 50

*** Putative Vector Insertion (Chr 5: 121985862 - 121987230) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189020 Chr5:121984344..121984439 AAGGGGTAAACTGGGGTGTC Chr5:121984339..121984358 60.09 55
downstream ENSMUSE00000189016 Chr5:121983318..121983398 GTAGGGTGTTGGCGAGGTAG Chr5:121983308..121983327 59.62 60
downstream ENSMUSE00000189019 Chr5:121981542..121981729 TTTTTCCGCATATCCTTTGG Chr5:121981598..121981617 59.9 40
downstream ENSMUSE00000189018 Chr5:121978879..121978999 CAACACTCCCTCGATTGTGA Chr5:121978929..121978948 59.68 50
downstream ENSMUSE00000688998 Chr5:121977167..121977230 GGTCCTGGATCCTCATGTTT Chr5:121977145..121977164 58.79 50
downstream ENSMUSE00000189021 Chr5:121977100..121977230 TCTTCCTGAGAATGGGGTTG Chr5:121977091..121977110 60.04 50
downstream ENSMUSE00000688994 Chr5:121976754..121976869 ATACCGTCCTTTGGCTTGGT Chr5:121976827..121976846 60.74 50
downstream ENSMUSE00000189015 Chr5:121976748..121976869 ATACCGTCCTTTGGCTTGGT Chr5:121976827..121976846 60.74 50
downstream ENSMUSE00000189012 Chr5:121975672..121975776 ATTCGCGGTTGTACTTCCAG Chr5:121975692..121975711 60.13 50
downstream ENSMUSE00000688996 Chr5:121975672..121975773 ATTCGCGGTTGTACTTCCAG Chr5:121975692..121975711 60.13 50
downstream ENSMUSE00000688989 Chr5:121975154..121975248 AAGGGTCTGCTCTTCGATCA Chr5:121975150..121975169 59.95 50
downstream ENSMUSE00000688986 Chr5:121975065..121975248 AAGGGTCTGCTCTTCGATCA Chr5:121975150..121975169 59.95 50
downstream ENSMUSE00000650004 Chr5:121975060..121975248 AAGGGTCTGCTCTTCGATCA Chr5:121975150..121975169 59.95 50
downstream ENSMUSE00000688992 Chr5:121975057..121975248 AAGGGTCTGCTCTTCGATCA Chr5:121975150..121975169 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCAAACAGGGCTCGACTC Chr5:121987218..121987238 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGGGGAGAGCTATTTCG Chr5:121987177..121987197 60.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029454