Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38702
Trapped Gene
Plxnb1 (ENSMUSG00000053646)
Vector Insertion
Chr 9: 109019172 - 109020353
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000470506 (Chr9:109019097..109019171 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCTCTGCATGAACTCTACA Chr9:109019125..109019145 59.61 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000470506 (Chr9:109019097..109019171 +)
Downstram Exon
ENSMUSE00000465562 (Chr9:109020354..109022422 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCTCTGCATGAACTCTACA Chr9:109019125..109019145 59.61 47.62 GTGACTCAGAGCACGTTCCA Chr9:109022360..109022379 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000475459 Chr9:108998106..108998159 No primer for this exon
upstream ENSMUSE00000481480 Chr9:109001785..109001837 AGGTCATGCCGTTATCTGCT Chr9:109001798..109001817 59.72 50
upstream ENSMUSE00000479504 Chr9:109002586..109003698 GGACCAAGGTTGCTGACATT Chr9:109003640..109003659 59.97 50
upstream ENSMUSE00000466155 Chr9:109004535..109004717 CTGGGTGACAGTCAAGGACA Chr9:109004688..109004707 59.71 55
upstream ENSMUSE00000472273 Chr9:109005088..109005216 GAAGTGCTGCCCCATATTCT Chr9:109005107..109005126 59.15 50
upstream ENSMUSE00000462527 Chr9:109005341..109005441 CTTATTGCGGATGGTGTGTG Chr9:109005411..109005430 59.99 50
upstream ENSMUSE00000517580 Chr9:109005729..109005861 GCCAATATCAGTCGGGAAGA Chr9:109005832..109005851 60.04 50
upstream ENSMUSE00000520660 Chr9:109006127..109006283 CTGGCCAGGGGAGTCATATT Chr9:109006159..109006178 61.23 55
upstream ENSMUSE00000516843 Chr9:109006542..109006650 TTACTGCGTCTTCCCCATCT Chr9:109006626..109006645 59.69 50
upstream ENSMUSE00000509421 Chr9:109006737..109006845 AGCAGCTGTGCACACACAAG Chr9:109006787..109006806 61.31 55
upstream ENSMUSE00000506740 Chr9:109007248..109007922 ACTCCTACCCCCAACAGCTT Chr9:109007326..109007345 59.99 55
upstream ENSMUSE00000508532 Chr9:109008105..109008227 AATCAGAGGGTGAGCTCCTG Chr9:109008114..109008133 59.4 55
upstream ENSMUSE00000495530 Chr9:109008430..109008552 CAGATGTCTGGTGCCACATC Chr9:109008515..109008534 60.12 55
upstream ENSMUSE00000498124 Chr9:109008775..109008868 AGCTTTGAAGCCAGAACTGC Chr9:109008786..109008805 59.76 50
upstream ENSMUSE00000497309 Chr9:109008955..109009127 AGCCTGTAATGAAGCCGAGA Chr9:109009070..109009089 59.98 50
upstream ENSMUSE00000500419 Chr9:109009274..109009425 GTCACTATCAGGGGCTCCAA Chr9:109009313..109009332 60.07 55
upstream ENSMUSE00000505313 Chr9:109010635..109010740 GAGGAGGTGACTGGCACTGT Chr9:109010663..109010682 60.31 60
upstream ENSMUSE00000502216 Chr9:109010921..109011057 GACTGGACGGCTAGAGGACA Chr9:109011004..109011023 60.41 60
upstream ENSMUSE00000501408 Chr9:109011313..109011489 AGCACGGCCAATTCAAGTAT Chr9:109011420..109011439 59.6 45
upstream ENSMUSE00000487963 Chr9:109011682..109011811 AACACGTGGTCCCTGAGAAA Chr9:109011792..109011811 60.54 50
upstream ENSMUSE00000487157 Chr9:109012004..109012246 GGGGTCCAGGTGGAGTTTAT Chr9:109012085..109012104 60.05 55
upstream ENSMUSE00000489816 Chr9:109012864..109013040 CCCTGCGTGGTAAAGACACT Chr9:109012924..109012943 60.17 55
upstream ENSMUSE00000489007 Chr9:109013117..109013265 GGTCATGTGCAGTACGATGG Chr9:109013147..109013166 59.99 55
upstream ENSMUSE00000492105 Chr9:109013972..109014072 GTACGGGACCGCTGTAAGAA Chr9:109014042..109014061 60.13 55
upstream ENSMUSE00000491359 Chr9:109014161..109014378 CGGTATCCCCTTCCTTGACT Chr9:109014207..109014226 60.32 55
upstream ENSMUSE00000493242 Chr9:109014475..109014653 ACGGACATACTGCGGACTCT Chr9:109014577..109014596 59.75 55
upstream ENSMUSE00000529525 Chr9:109014777..109014843 AAGCTGCTCACCAACTGGAT Chr9:109014796..109014815 59.87 50
upstream ENSMUSE00000486846 Chr9:109015019..109015165 ATGTGGAGTACCGTCCCTTG Chr9:109015146..109015165 59.84 55
upstream ENSMUSE00000490641 Chr9:109015798..109015966 TACAAGGGAGTGCCTCTTGC Chr9:109015915..109015934 60.4 55
upstream ENSMUSE00000471802 Chr9:109016155..109016258 ACGTCACTTCCGAACTCCAG Chr9:109016200..109016219 60.3 55
upstream ENSMUSE00000478556 Chr9:109016334..109016418 GGGAAAACCAGGATTATGTCC Chr9:109016389..109016409 59.52 47.62
upstream ENSMUSE00000443318 Chr9:109016762..109016934 AAAGCCGAGTGATGAACCAG Chr9:109016817..109016836 60.26 50
upstream ENSMUSE00000529519 Chr9:109017091..109017251 TGCTGGATGAACAAGCTCAG Chr9:109017182..109017201 60.14 50
upstream ENSMUSE00000475951 Chr9:109017337..109017484 CCCACAGTTTGTGTTCGATG Chr9:109017373..109017392 60 50
upstream ENSMUSE00000482627 Chr9:109018021..109018085 GCTCGAGATATTCCCCGTTA Chr9:109018048..109018067 59.14 50
upstream ENSMUSE00000471425 Chr9:109018209..109018284 GCCAGTGACCAAGAGATGAACT Chr9:109018240..109018261 60.69 50
upstream ENSMUSE00000470506 Chr9:109019097..109019171 TGGCTCTGCATGAACTCTACA Chr9:109019125..109019145 59.61 47.62

*** Putative Vector Insertion (Chr 9: 109019172 - 109020353) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465562 Chr9:109020354..109022422 GTGACTCAGAGCACGTTCCA Chr9:109022360..109022379 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGCTTAATCGCCTTGCAG Chr9:109019217..109019237 60.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000053646