Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38717
Trapped Gene
OTTMUSG00000016321 (ENSMUSG00000078864)
Vector Insertion
Chr 2: 177502876 - 177503080
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678572 (Chr2:177502749..177502875 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTGCTGCATCCTTCTCAG Chr2:177502801..177502820 58.75 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678572 (Chr2:177502749..177502875 +)
Downstram Exon
ENSMUSE00000678571 (Chr2:177503081..177503141 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTGCTGCATCCTTCTCAG Chr2:177502801..177502820 58.75 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678574 Chr2:177493998..177494080 TGGGAGTTGTGAGAGGAGGT Chr2:177494035..177494054 59.68 55
upstream ENSMUSE00000714580 Chr2:177497551..177497605 No primer for this exon
upstream ENSMUSE00000678572 Chr2:177502749..177502875 CTTTGCTGCATCCTTCTCAG Chr2:177502801..177502820 58.75 50

*** Putative Vector Insertion (Chr 2: 177502876 - 177503080) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678571 Chr2:177503081..177503141 No primer for this exon
downstream ENSMUSE00000678569 Chr2:177504292..177505177 CCTGCATGTGTTCGCTTATG Chr2:177504735..177504754 60.28 50
downstream ENSMUSE00000678570 Chr2:177504292..177507393 CTGCACGGCTCTCAACATTA Chr2:177506706..177506725 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000078864