Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38718
Trapped Gene
Zfp445 (ENSMUSG00000047036)
Vector Insertion
Chr 9: 122770826 - 122775070
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000688069 (Chr9:122775032..122775069 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCATTAGGAAGAATGCTGAGT Chr9:122775048..122775069 59.75 45.46 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000688069 (Chr9:122775032..122775069 -)
Downstram Exon
ENSMUSE00000432277 (Chr9:122770827..122771377 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCATTAGGAAGAATGCTGAGT Chr9:122775048..122775069 59.75 45.46 GGAGGCATCACTCCTATCCA Chr9:122771217..122771236 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688069 Chr9:122775032..122775069 GCCATTAGGAAGAATGCTGAGT Chr9:122775048..122775069 59.75 45.46
upstream ENSMUSE00000432277 Chr9:122770827..122771377 GCAGAGGGATCTTGATGGAA Chr9:122770838..122770857 60.16 50

*** Putative Vector Insertion (Chr 9: 122770826 - 122775070) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000432254 Chr9:122766588..122766756 CCAGGACGTCACAAATTCCT Chr9:122766578..122766597 59.97 50
downstream ENSMUSE00000388587 Chr9:122766221..122766279 CACCGAGACAGCAGGAGAAT Chr9:122766238..122766257 60.41 55
downstream ENSMUSE00000342876 Chr9:122765817..122765943 AGATTGCGCTGAGCTGAGTT Chr9:122765842..122765861 60.31 50
downstream ENSMUSE00000375471 Chr9:122763825..122763935 ATCAGAGCAGGTTTGGGAGA Chr9:122763886..122763905 59.8 50
downstream ENSMUSE00000494460 Chr9:122760143..122763106 CACACACCCTGCATTGAAAC Chr9:122762545..122762564 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000047036