Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3872
Trapped Gene
Ano6 (ENSMUSG00000064210)
Vector Insertion
Chr 15: 95694739 - 95724843
Public Clones AW0382 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000552654 (Chr15:95694656..95694738 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACCTTTGGATCACTGGAG Chr15:95694689..95694708 60.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000552654 (Chr15:95694656..95694738 +)
Downstram Exon
ENSMUSE00000552653 (Chr15:95724844..95724972 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACCTTTGGATCACTGGAG Chr15:95694689..95694708 60.5 55 GGGCTTCCCGTTAAATTCTT Chr15:95724867..95724886 59.44 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000501868 Chr15:95621274..95621487 ACGACGATGAGGATGGAGAC Chr15:95621464..95621483 60.08 55
upstream ENSMUSE00000552654 Chr15:95694656..95694738 CCACCTTTGGATCACTGGAG Chr15:95694689..95694708 60.5 55

*** Putative Vector Insertion (Chr 15: 95694739 - 95724843) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000552653 Chr15:95724844..95724972 GGGCTTCCCGTTAAATTCTT Chr15:95724867..95724886 59.44 45
downstream ENSMUSE00000552652 Chr15:95742736..95742801 AGCCCATGGCAGATAAGGTT Chr15:95742782..95742801 60.85 50
downstream ENSMUSE00000552651 Chr15:95743803..95744087 ATTCATCCGGCTCTTCTCAA Chr15:95744033..95744052 59.77 45
downstream ENSMUSE00000552650 Chr15:95744303..95744416 TTTGACCCGAGAGAGGATGA Chr15:95744332..95744351 60.74 50
downstream ENSMUSE00000552648 Chr15:95746384..95746499 AGGTAACGCTCGCTAGGACA Chr15:95746439..95746458 60.04 55
downstream ENSMUSE00000552647 Chr15:95750675..95750809 ATTCCAATCTTCTCGCCGTA Chr15:95750704..95750723 59.67 45
downstream ENSMUSE00000552646 Chr15:95757955..95758060 CACCGATGTCAGGATCACAG Chr15:95757986..95758005 60.11 55
downstream ENSMUSE00000552645 Chr15:95762214..95762274 CGAAGATCAGGGTTCCAAAA Chr15:95762256..95762275 60.04 45
downstream ENSMUSE00000552642 Chr15:95771641..95771783 TGCTGTAGCTCAACGGTGTC Chr15:95771719..95771738 60.06 55
downstream ENSMUSE00000679553 Chr15:95773585..95773614 AAAGGCTCTCAGCCATCAGA Chr15:95773612..95773631 60.1 50
downstream ENSMUSE00000347512 Chr15:95773829..95773906 ACAGGTGGTAAATGGGATGC Chr15:95773861..95773880 59.68 50
downstream ENSMUSE00000275040 Chr15:95778703..95778928 TGAACACGGACAGCCTGTAG Chr15:95778763..95778782 59.9 55
downstream ENSMUSE00000275079 Chr15:95779922..95780091 TGCGATGTAGAAGCATGAGG Chr15:95780022..95780041 59.97 50
downstream ENSMUSE00000275072 Chr15:95780290..95780387 GATGATCGTCAGCTGTGTGG Chr15:95780343..95780362 60.28 55
downstream ENSMUSE00000275066 Chr15:95786322..95786452 GGCTGCAGATGGTAATCCTG Chr15:95786414..95786433 60.62 55
downstream ENSMUSE00000275059 Chr15:95792507..95792712 TTCCACGCGTCCACTCTTAT Chr15:95792612..95792631 60.66 50
downstream ENSMUSE00000275033 Chr15:95796252..95796454 TGTAGCCGTCCATGGTGTAA Chr15:95796363..95796382 59.99 50
downstream ENSMUSE00000275052 Chr15:95798054..95798159 GGCAATCACGTGCCAATAGT Chr15:95798132..95798151 60.92 50
downstream ENSMUSE00000474865 Chr15:95802926..95805180 ACAGAGGCGATTAAGGCTGA Chr15:95803571..95803590 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCGGGGAACTCTGATGTG Chr15:95721723..95721743 60.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCGGGGAACTCTGATGTG Chr15:95721723..95721743 60.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064210