Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3874
Trapped Gene
Vapa (ENSMUSG00000024091)
Vector Insertion
Chr 17: 65941712 - 65942779
Public Clones AW0373 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138298 (Chr17:65942780..65942883 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGCTCCACCAAACATTTCA Chr17:65942795..65942814 60.09 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138298 (Chr17:65942780..65942883 -)
Downstram Exon
ENSMUSE00000138302 (Chr17:65941631..65941711 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGCTCCACCAAACATTTCA Chr17:65942795..65942814 60.09 40 TTCATTCGGCATTTCAAACA Chr17:65941621..65941640 60.05 35

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000306239 Chr17:65962560..65962836 CTCGACCCTCCTTCAGACCT Chr17:65962571..65962590 60.78 60
upstream ENSMUSE00000540917 Chr17:65944242..65944394 CGGGGTCAATTGTGACTGTT Chr17:65944246..65944265 60.81 50
upstream ENSMUSE00000138298 Chr17:65942780..65942883 TTGCTCCACCAAACATTTCA Chr17:65942795..65942814 60.09 40

*** Putative Vector Insertion (Chr 17: 65941712 - 65942779) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138302 Chr17:65941631..65941711 TTCATTCGGCATTTCAAACA Chr17:65941621..65941640 60.05 35
downstream ENSMUSE00000138301 Chr17:65931920..65932093 AGTCGCTTGCACTCTTCCAT Chr17:65931944..65931963 60.02 50
downstream ENSMUSE00000381941 Chr17:65929396..65930187 CCAGGTTTATCCGAATGTGC Chr17:65930119..65930138 60.33 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000024091