Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI389
Trapped Gene
Kcnh7 (ENSMUSG00000059742)
Vector Insertion
Chr 2: 62624337 - 62626073
Public Clones GC1328 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691727 (Chr2:62624424..62626072 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTGGTTCCTGATTGACAT Chr2:62625699..62625718 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691727 (Chr2:62624424..62626072 -)
Downstram Exon
ENSMUSE00000691730 (Chr2:62624338..62626072 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTGGTTCCTGATTGACAT Chr2:62625699..62625718 59.93 50 ACCCAGCCTAAAGTGTGTGG Chr2:62624591..62624610 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000493488 Chr2:63022059..63022227 GGGGACCATCATACGGAAAT Chr2:63022071..63022090 60.78 50
upstream ENSMUSE00000691731 Chr2:63022059..63022344 TCTGCTCCCCAAAGAAGATG Chr2:63022237..63022256 60.33 50
upstream ENSMUSE00000691738 Chr2:63022059..63022335 TCTGCTCCCCAAAGAAGATG Chr2:63022237..63022256 60.33 50
upstream ENSMUSE00000494543 Chr2:63020113..63020343 CAGAAGCCGTGTACCTGTGA Chr2:63020220..63020239 59.9 55
upstream ENSMUSE00000503267 Chr2:62715259..62715414 CAGAGAGGGTCAACCCGATA Chr2:62715281..62715300 60.06 55
upstream ENSMUSE00000504286 Chr2:62688407..62688835 CTCCCACGAAAGAAAGTTGC Chr2:62688675..62688694 59.85 50
upstream ENSMUSE00000504344 Chr2:62683811..62683831 No primer for this exon
upstream ENSMUSE00000505324 Chr2:62675123..62675337 TGGGATCCACATCAGATTCA Chr2:62675288..62675307 59.85 45
upstream ENSMUSE00000498792 Chr2:62625647..62626072 AAAAGGCGAGAATGTGGCTA Chr2:62625864..62625883 59.85 45
upstream ENSMUSE00000691727 Chr2:62624424..62626072 GGCTGGTTCCTGATTGACAT Chr2:62625699..62625718 59.93 50
upstream ENSMUSE00000691730 Chr2:62624338..62626072 GGCTGGTTCCTGATTGACAT Chr2:62625699..62625718 59.93 50

*** Putative Vector Insertion (Chr 2: 62624337 - 62626073) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000499793 Chr2:62615339..62615738 AGCCGCACCATATTCTGAGT Chr2:62615621..62615640 59.72 50
downstream ENSMUSE00000500806 Chr2:62602628..62602827 ATTTGGTGGAAGCGAATGAA Chr2:62602685..62602704 60.45 40
downstream ENSMUSE00000469102 Chr2:62577201..62577453 TTCAGATGCAGGCAAATGTC Chr2:62577379..62577398 59.81 45
downstream ENSMUSE00000470258 Chr2:62574030..62574235 ACTTGCCAGGTTTGGCATAA Chr2:62574160..62574179 60.5 45
downstream ENSMUSE00000471142 Chr2:62572276..62572357 CAAAGGACAATCGCCTTCTC Chr2:62572272..62572291 59.81 50
downstream ENSMUSE00000511582 Chr2:62559744..62560007 GTCAGCGTCATTTGCACTGT Chr2:62559951..62559970 59.91 50
downstream ENSMUSE00000512654 Chr2:62554165..62554333 GGCAGCTCTCTGAAGTCCTG Chr2:62554226..62554245 60.28 60
downstream ENSMUSE00000513736 Chr2:62543973..62544165 GGTTCTCAACAGACGGAGGA Chr2:62544005..62544024 60.24 55
downstream ENSMUSE00000506990 Chr2:62531471..62541269 ATAGCAGCAGGCGAACATCT Chr2:62538006..62538025 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTTCTTTCTTTGGGAGCA Chr2:62626053..62626073 58.91 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTTCTTTCTTTGGGAGCA Chr2:62626053..62626073 58.91 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059742