Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3893
Trapped Gene
Mepce (ENSMUSG00000029726)
Vector Insertion
Chr 5: 138225688 - 138227291
Public Clones AW0092 (sanger) W247D05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000686186 (Chr5:138227243..138227290 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAGGAGCCCTTTCTGGTG Chr5:138227252..138227271 60.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000686186 (Chr5:138227243..138227290 -)
Downstram Exon
ENSMUSE00000341513 (Chr5:138225689..138227891 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAGGAGCCCTTTCTGGTG Chr5:138227252..138227271 60.76 55 AGACGACATTGTTGGGGAAG Chr5:138225675..138225694 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686186 Chr5:138227243..138227290 AGAAGGAGCCCTTTCTGGTG Chr5:138227252..138227271 60.76 55
upstream ENSMUSE00000686185 Chr5:138227116..138227241 CTCCGTGATGGGACAGAACA Chr5:138227145..138227164 62.11 55
upstream ENSMUSE00000686184 Chr5:138227055..138227114 No primer for this exon
upstream ENSMUSE00000341513 Chr5:138225689..138227891 CTCTCGGAGCCGTTAAGTTG Chr5:138227659..138227678 60.01 55
upstream ENSMUSE00000686183 Chr5:138225689..138227050 CTTCCCCAACAATGTCGTCT Chr5:138225697..138225716 59.97 50

*** Putative Vector Insertion (Chr 5: 138225688 - 138227291) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000192094 Chr5:138224358..138224576 CTCATCTCGGTCCAGGACAT Chr5:138224528..138224547 60.07 55
downstream ENSMUSE00000192093 Chr5:138223823..138223949 GGAGGTGTTATTCGGTGTGG Chr5:138223805..138223824 60.23 55
downstream ENSMUSE00000395812 Chr5:138223135..138223712 CAAGTACACAGGACGCTGGA Chr5:138223668..138223687 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCTTGAGAAGGGGAAATTA Chr5:138227303..138227323 59.29 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCTTGAGAAGGGGAAATTA Chr5:138227303..138227323 59.29 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029726