Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3897
Trapped Gene
Rabgap1 (ENSMUSG00000035437)
Vector Insertion
Chr 2: 37364599 - 37388035
Public Clones AW0078 (sanger) RRM217 (baygenomics) RRJ627 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000645559 (Chr2:37364448..37364598 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCACAACAACGATCACTT Chr2:37364548..37364567 60.16 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000645559 (Chr2:37364448..37364598 +)
Downstram Exon
ENSMUSE00000645558 (Chr2:37388036..37388149 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCACAACAACGATCACTT Chr2:37364548..37364567 60.16 45 GCTGGAAATGTGCGGTTAAT Chr2:37388091..37388110 59.97 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000255079 Chr2:37298805..37298976 AGCTCTGCTGCTTGTGGTTC Chr2:37298848..37298867 60.74 55
upstream ENSMUSE00000495792 Chr2:37307774..37307821 No primer for this exon
upstream ENSMUSE00000693651 Chr2:37307787..37307821 No primer for this exon
upstream ENSMUSE00000645590 Chr2:37324897..37325096 CAAGGCCTCTGTTGGAAAAA Chr2:37324955..37324974 60.22 45
upstream ENSMUSE00000712432 Chr2:37324897..37325096 CAAGGCCTCTGTTGGAAAAA Chr2:37324955..37324974 60.22 45
upstream ENSMUSE00000645589 Chr2:37327815..37328034 GCTTCCGAAACCAGAGATGA Chr2:37327988..37328007 60.34 50
upstream ENSMUSE00000645588 Chr2:37329099..37329303 TAACCCTCTCAGTGCCGAAT Chr2:37329264..37329283 59.69 50
upstream ENSMUSE00000645587 Chr2:37330812..37330986 AGGACATGATGGGACTCCTG Chr2:37330881..37330900 59.92 55
upstream ENSMUSE00000645586 Chr2:37339248..37339405 ACAGACTCCTGACAGCGACA Chr2:37339328..37339347 59.6 55
upstream ENSMUSE00000645585 Chr2:37342586..37342696 AGACAAGGACAGGCAATGCT Chr2:37342598..37342617 59.87 50
upstream ENSMUSE00000645580 Chr2:37343032..37343098 CCAGGAAAAGATGTCCGAAA Chr2:37343054..37343073 60.04 45
upstream ENSMUSE00000645574 Chr2:37345251..37345353 TATGGGCAAAAGTTCAGATGG Chr2:37345256..37345276 59.95 42.86
upstream ENSMUSE00000645570 Chr2:37347430..37347599 CCTTCAGCAAACGAAGCACT Chr2:37347550..37347569 60.57 50
upstream ENSMUSE00000645569 Chr2:37351103..37351277 AGAGCTCCATGATCCCCTCT Chr2:37351233..37351252 60.18 55
upstream ENSMUSE00000645564 Chr2:37358388..37358481 AAACATGGGGAGAACTGCTG Chr2:37358454..37358473 60.11 50
upstream ENSMUSE00000645559 Chr2:37364448..37364598 TGCCACAACAACGATCACTT Chr2:37364548..37364567 60.16 45

*** Putative Vector Insertion (Chr 2: 37364599 - 37388035) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645558 Chr2:37388036..37388149 GCTGGAAATGTGCGGTTAAT Chr2:37388091..37388110 59.97 45
downstream ENSMUSE00000645557 Chr2:37392822..37392896 GTACAGCTGCGAGGAAGGAC Chr2:37392888..37392907 60.02 60
downstream ENSMUSE00000645556 Chr2:37395937..37396062 GCGCTCCAACTGGTAGAACT Chr2:37396056..37396075 59.5 55
downstream ENSMUSE00000567436 Chr2:37396553..37396696 TCCAGGAAGTGGTTGTACAGG Chr2:37396589..37396609 60.01 52.38
downstream ENSMUSE00000451286 Chr2:37398157..37398198 TCCAAGGGCGACATTAAAGA Chr2:37398192..37398211 60.58 45
downstream ENSMUSE00000254950 Chr2:37398623..37398751 AGAACTTCAAGGCACCCTCA Chr2:37398677..37398696 59.84 50
downstream ENSMUSE00000402505 Chr2:37398623..37400482 CAAAAAGGGGCACTTGATGT Chr2:37398873..37398892 59.97 45
downstream ENSMUSE00000693640 Chr2:37398623..37398772 AGAACTTCAAGGCACCCTCA Chr2:37398677..37398696 59.84 50
downstream ENSMUSE00000254942 Chr2:37411226..37411318 CTGCTCCCTCATGGTATGGTA Chr2:37411284..37411304 59.96 52.38
downstream ENSMUSE00000254935 Chr2:37411716..37411826 CAATGCAATTTTGCTGGTGA Chr2:37411811..37411830 60.64 40
downstream ENSMUSE00000567434 Chr2:37415995..37416099 TGCATCAATCAGCTTCTGCT Chr2:37416063..37416082 59.7 45
downstream ENSMUSE00000254925 Chr2:37416889..37416972 No primer for this exon
downstream ENSMUSE00000254917 Chr2:37417412..37417483 TTGGCTGTCTGTTGCTTTTC Chr2:37417461..37417480 59.05 45
downstream ENSMUSE00000254911 Chr2:37418956..37419153 GCAGCGGTCACAGTCATCTA Chr2:37418985..37419004 60.02 55
downstream ENSMUSE00000451010 Chr2:37420285..37421957 CCAAGCTACCTGCACACAGA Chr2:37421648..37421667 60.05 55
downstream ENSMUSE00000693649 Chr2:37420285..37421974 CCAAGCTACCTGCACACAGA Chr2:37421648..37421667 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGTAACCAGAGGCCGAAA Chr2:37370562..37370582 58.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTCCACTGCACTTTCTTTG Chr2:37370559..37370580 59.9 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035437