Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3913
Trapped Gene
Ubl3 (ENSMUSG00000001687)
Vector Insertion
Chr 5: 149320932 - 149323469
Public Clones AH0678 (sanger) AT0900 (sanger) AS0721 (sanger) (sanger)
AR0406 (sanger) AE0039 (sanger) (sanger) AS0576 (sanger) AP0575 (sanger)
AS0278 (sanger) (sanger) AS0109 (sanger) CSH459 (baygenomics) D171C06 (ggtc)
D171C06 (ggtc) IST14954D3 (tigm) IST12846C8 (tigm)
Private Clones OST461974 (lexicon) OST449632 (lexicon) OST413496 (lexicon) OST381033 (lexicon)
OST359982 (lexicon) OST349153 (lexicon) OST335242 (lexicon) OST301290 (lexicon)
OST182572 (lexicon) OST179821 (lexicon) OST177699 (lexicon) OST168457 (lexicon)
OST142873 (lexicon) OST102773 (lexicon) OST64177 (lexicon) OST45325 (lexicon)
OST43152 (lexicon) OST38863 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000404861 (Chr5:149323470..149323578 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000404861 (Chr5:149323470..149323578 -)
Downstram Exon
ENSMUSE00000191057 (Chr5:149320845..149320931 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684215 Chr5:149363529..149364041 No primer for this exon
upstream ENSMUSE00000404861 Chr5:149323470..149323578 No primer for this exon

*** Putative Vector Insertion (Chr 5: 149320932 - 149323469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000191057 Chr5:149320845..149320931 No primer for this exon
downstream ENSMUSE00000191055 Chr5:149318022..149318099 No primer for this exon
downstream ENSMUSE00000647629 Chr5:149316239..149317763 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTACCGGCTGCTTGACTCTT Chr5:149323444..149323464 59.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTACCGGCTGCTTGACTCTT Chr5:149323444..149323464 59.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGTGAGTGGGAAGACGAAAG Chr5:149323537..149323557 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTGAGTGGGAAGACGAAAG Chr5:149323537..149323557 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001687