Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3969
Trapped Gene
Csde1 (ENSMUSG00000068823)
Vector Insertion
Chr 3: 102843966 - 102844363
Public Clones AS0065 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318141 (Chr3:102843856..102843965 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCATCTGACCGGAGGACTG Chr3:102843875..102843894 60.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318141 (Chr3:102843856..102843965 +)
Downstram Exon
ENSMUSE00000318135 (Chr3:102844364..102844456 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCATCTGACCGGAGGACTG Chr3:102843875..102843894 60.07 55 CTCCCTGTTGGACTCTGACC Chr3:102844437..102844456 59.68 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359109 Chr3:102824530..102824592 No primer for this exon
upstream ENSMUSE00000715379 Chr3:102832712..102833135 CACTTCCCAACGCTGCTAGT Chr3:102832883..102832902 60.45 55
upstream ENSMUSE00000716412 Chr3:102832712..102833135 CACTTCCCAACGCTGCTAGT Chr3:102832883..102832902 60.45 55
upstream ENSMUSE00000637043 Chr3:102842615..102842813 TCAGTGTTCAGAACGGCAAG Chr3:102842734..102842753 60.03 50
upstream ENSMUSE00000671436 Chr3:102842615..102842813 TCAGTGTTCAGAACGGCAAG Chr3:102842734..102842753 60.03 50
upstream ENSMUSE00000318141 Chr3:102843856..102843965 ATCATCTGACCGGAGGACTG Chr3:102843875..102843894 60.07 55

*** Putative Vector Insertion (Chr 3: 102843966 - 102844363) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000318135 Chr3:102844364..102844456 CTCCCTGTTGGACTCTGACC Chr3:102844437..102844456 59.68 60
downstream ENSMUSE00000318132 Chr3:102845068..102845165 TCCAGCTGAACATTCCCTTC Chr3:102845126..102845145 60.19 50
downstream ENSMUSE00000318128 Chr3:102847080..102847161 CGAGCCTGCTTCTTTTTCAA Chr3:102847136..102847155 60.63 45
downstream ENSMUSE00000318123 Chr3:102847480..102847608 TGAATTCCACGTCATCTCCA Chr3:102847594..102847613 60.05 45
downstream ENSMUSE00000318118 Chr3:102847729..102847854 TGACTGTTCCTTGAGGCAAT Chr3:102847780..102847799 58.29 45
downstream ENSMUSE00000318109 Chr3:102848552..102848764 GGTTGCTCGTTCCAATTTGT Chr3:102848713..102848732 59.98 45
downstream ENSMUSE00000318103 Chr3:102850708..102850848 GTGGAGCTGGTTCCCATCTA Chr3:102850818..102850837 60.07 55
downstream ENSMUSE00000318099 Chr3:102850937..102851101 TTTGCCTTTATTTGGGCTTG Chr3:102851098..102851117 60.07 40
downstream ENSMUSE00000318092 Chr3:102853544..102853651 TTCACCCCACAGTCGTCATA Chr3:102853590..102853609 59.96 50
downstream ENSMUSE00000372125 Chr3:102854221..102854396 GCCACATAACCCAAGAGACG Chr3:102854330..102854349 60.52 55
downstream ENSMUSE00000318079 Chr3:102854963..102855075 ACCATGTCTCCCAGTTCCAG Chr3:102855010..102855029 59.96 55
downstream ENSMUSE00000318072 Chr3:102856735..102856854 GAGGGCGAATGACTTTACCA Chr3:102856797..102856816 60.07 50
downstream ENSMUSE00000318065 Chr3:102858578..102858756 CCTACGAAGGGGTGTGATGT Chr3:102858732..102858751 59.84 55
downstream ENSMUSE00000173638 Chr3:102859272..102859435 CCAGTGCGCTGATTAAGGAT Chr3:102859405..102859424 60.24 50
downstream ENSMUSE00000173639 Chr3:102860268..102860400 CTTGGCTGACGAAGAACCAT Chr3:102860384..102860403 60.26 50
downstream ENSMUSE00000507197 Chr3:102860809..102862108 GGAACCACGGGGCTATTTAT Chr3:102861771..102861790 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCTTAGGGCCCCATATTT Chr3:102843991..102844011 59.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCTTAGGGCCCCATATTT Chr3:102843991..102844011 59.64 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068823