Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3970
Trapped Gene
Rbbp4 (ENSMUSG00000057236)
Vector Insertion
Chr 4: 128999225 - 128999322
Public Clones AS0054 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000182362 (Chr4:128999323..128999483 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGTGGTGGATGCAAAGAC Chr4:128999422..128999441 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000182362 (Chr4:128999323..128999483 -)
Downstram Exon
ENSMUSE00000411932 (Chr4:128999098..128999224 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGTGGTGGATGCAAAGAC Chr4:128999422..128999441 59.97 50 TGTGTGAGCATCAACCGAGT Chr4:128999145..128999164 60.32 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662048 Chr4:129012462..129012584 No primer for this exon
upstream ENSMUSE00000662047 Chr4:129011741..129011888 AAGAACGGGTGATCAACGAG Chr4:129011848..129011867 60.11 50
upstream ENSMUSE00000474672 Chr4:129005832..129005977 CCAGTGTCCAGCTCCCTAAT Chr4:129005878..129005897 59.16 55
upstream ENSMUSE00000182353 Chr4:128999940..129000113 CTCAGAACCCCTGCATCATT Chr4:129000004..129000023 60.07 50
upstream ENSMUSE00000182364 Chr4:128999597..128999712 ACCCTTCTGGAGAATGCAAC Chr4:128999693..128999712 59.14 50
upstream ENSMUSE00000182362 Chr4:128999323..128999483 AAGGTGGTGGATGCAAAGAC Chr4:128999422..128999441 59.97 50

*** Putative Vector Insertion (Chr 4: 128999225 - 128999322) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411932 Chr4:128999098..128999224 TGTGTGAGCATCAACCGAGT Chr4:128999145..128999164 60.32 50
downstream ENSMUSE00000364055 Chr4:128997713..128997790 GGGATTCAAAGGAGTGCAAC Chr4:128997711..128997730 59.53 50
downstream ENSMUSE00000182356 Chr4:128995688..128995764 ACGATCGGTACCACTGGAAG Chr4:128995689..128995708 59.99 55
downstream ENSMUSE00000182368 Chr4:128995106..128995163 CATCTTCTGGGGACTGCTCT Chr4:128995110..128995129 59.4 55
downstream ENSMUSE00000467517 Chr4:128994892..128995002 AACAAATCACCCAAGGCTCA Chr4:128994908..128994927 60.49 45
downstream ENSMUSE00000662046 Chr4:128986762..128987401 GGGCTTGTAGCATTGTTGGT Chr4:128987180..128987199 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGGCTCAGTTGCTGATGA Chr4:128999336..128999356 60.54 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGGCTCAGTTGCTGATGA Chr4:128999336..128999356 60.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057236