Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3972
Trapped Gene
Ddx39 (ENSMUSG00000005481)
Vector Insertion
Chr 8: 86245632 - 86245752
Public Clones AS0038 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434950 (Chr8:86245633..86245751 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434950 (Chr8:86245633..86245751 +)
Downstram Exon
ENSMUSE00000706424 (Chr8:86245633..86245751 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606769 Chr8:86239167..86239236 No primer for this exon
upstream ENSMUSE00000681691 Chr8:86239447..86239745 No primer for this exon
upstream ENSMUSE00000708243 Chr8:86243286..86243497 No primer for this exon
upstream ENSMUSE00000708889 Chr8:86243286..86243497 No primer for this exon
upstream ENSMUSE00000718405 Chr8:86243286..86243497 No primer for this exon
upstream ENSMUSE00000581499 Chr8:86243711..86243838 No primer for this exon
upstream ENSMUSE00000706428 Chr8:86243711..86243838 No primer for this exon
upstream ENSMUSE00000581498 Chr8:86244448..86244540 No primer for this exon
upstream ENSMUSE00000706427 Chr8:86244448..86244540 No primer for this exon
upstream ENSMUSE00000581497 Chr8:86244856..86245039 No primer for this exon
upstream ENSMUSE00000706426 Chr8:86244856..86245039 No primer for this exon
upstream ENSMUSE00000706425 Chr8:86245365..86245423 No primer for this exon

*** Putative Vector Insertion (Chr 8: 86245632 - 86245752) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434950 Chr8:86245633..86245751 No primer for this exon
downstream ENSMUSE00000706424 Chr8:86245633..86245751 No primer for this exon
downstream ENSMUSE00000581496 Chr8:86246129..86246260 No primer for this exon
downstream ENSMUSE00000706423 Chr8:86246129..86246260 No primer for this exon
downstream ENSMUSE00000581495 Chr8:86246348..86246457 No primer for this exon
downstream ENSMUSE00000434942 Chr8:86246548..86246692 No primer for this exon
downstream ENSMUSE00000434938 Chr8:86246786..86246933 No primer for this exon
downstream ENSMUSE00000606768 Chr8:86247024..86247247 No primer for this exon
downstream ENSMUSE00000706430 Chr8:86247024..86247174 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACACTCAGGCTTGCGATT Chr8:86245596..86245616 60.02 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACACTCAGGCTTGCGATT Chr8:86245596..86245616 60.02 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005481