Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3988
Trapped Gene
Herc2 (ENSMUSG00000030451)
Vector Insertion
Chr 7: 63306319 - 63323353
Public Clones AR0530 (sanger) RRG003 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673647 (Chr7:63306226..63306318 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCTCGCCTTGACTCCAAAT Chr7:63306279..63306298 59.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673647 (Chr7:63306226..63306318 +)
Downstram Exon
ENSMUSE00000593502 (Chr7:63323354..63323468 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCTCGCCTTGACTCCAAAT Chr7:63306279..63306298 59.29 50 ACCATTTCGTTCCACAGACC Chr7:63323403..63323422 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000519333 Chr7:63305623..63305672 No primer for this exon
upstream ENSMUSE00000673647 Chr7:63306226..63306318 GTCTCGCCTTGACTCCAAAT Chr7:63306279..63306298 59.29 50

*** Putative Vector Insertion (Chr 7: 63306319 - 63323353) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000593502 Chr7:63323354..63323468 ACCATTTCGTTCCACAGACC Chr7:63323403..63323422 59.83 50
downstream ENSMUSE00000593501 Chr7:63327663..63327800 TCCACTCTGAGCATCGACAC Chr7:63327691..63327710 59.99 55
downstream ENSMUSE00000593500 Chr7:63340359..63340578 AATGAAGTAGCGCTCGAGGA Chr7:63340495..63340514 60.12 50
downstream ENSMUSE00000593499 Chr7:63342710..63342810 AAGCAAAGGCGAAGGAGAGT Chr7:63342789..63342808 60.52 50
downstream ENSMUSE00000593498 Chr7:63343627..63343783 CCTCCAACCACACAGAGGAT Chr7:63343743..63343762 59.96 55
downstream ENSMUSE00000593497 Chr7:63346285..63346395 CTAAGCGTGCCTCTCTGGAC Chr7:63346398..63346417 60.16 60
downstream ENSMUSE00000593496 Chr7:63347909..63348080 GCATGTCGCTCTCTGTGTGT Chr7:63348081..63348100 60.06 55
downstream ENSMUSE00000593495 Chr7:63349635..63349808 GCCAGACGGTCTAGATGAGC Chr7:63349765..63349784 59.98 60
downstream ENSMUSE00000593494 Chr7:63352747..63352935 GGATCGGACCAATCACATTC Chr7:63352822..63352841 60.14 50
downstream ENSMUSE00000593493 Chr7:63353705..63353856 GAATGGGCAGCAATTTTCAC Chr7:63353766..63353785 60.46 45
downstream ENSMUSE00000593492 Chr7:63355449..63355606 CTGAGAAAGCCGAGATCACC Chr7:63355489..63355508 59.95 55
downstream ENSMUSE00000593491 Chr7:63355698..63355811 CATTGGAATGGCCTCATCTT Chr7:63355729..63355748 59.89 45
downstream ENSMUSE00000593490 Chr7:63359098..63359349 CCATGACCAAGCCTCTGATT Chr7:63359305..63359324 60.07 50
downstream ENSMUSE00000593489 Chr7:63361709..63361902 CTTGGTCACACGCAAAGTGT Chr7:63361836..63361855 59.79 50
downstream ENSMUSE00000593488 Chr7:63364056..63364256 GGAGATCCAGCTGCTCAAAC Chr7:63364155..63364174 59.96 55
downstream ENSMUSE00000593487 Chr7:63368415..63368643 CAGACCAGCCGCTCTGTAGT Chr7:63368586..63368605 60.61 60
downstream ENSMUSE00000593486 Chr7:63368768..63368892 AAGCTGACTCCAATCCTCCA Chr7:63368866..63368885 59.8 50
downstream ENSMUSE00000593485 Chr7:63370072..63370250 CAAGCACTGTTTGCCAGATG Chr7:63370221..63370240 60.45 50
downstream ENSMUSE00000593484 Chr7:63376915..63377099 TCCAGTGAAGCCGATCTTTC Chr7:63377022..63377041 60.34 50
downstream ENSMUSE00000593483 Chr7:63377683..63377838 AAAGTCCCCTTCCATTACGC Chr7:63377837..63377856 60.32 50
downstream ENSMUSE00000593482 Chr7:63379567..63379752 GTTGAAACGATCCAGGTGCT Chr7:63379694..63379713 60.12 50
downstream ENSMUSE00000593481 Chr7:63386539..63386709 ACAGTCCAGAAGCCACCATC Chr7:63386644..63386663 60.12 55
downstream ENSMUSE00000593480 Chr7:63387169..63387272 CAGAGCGACCACTGGATCTT Chr7:63387206..63387225 60.41 55
downstream ENSMUSE00000593479 Chr7:63387792..63387942 GAAGTAGGCCCAGGTTCCTC Chr7:63387879..63387898 60.07 60
downstream ENSMUSE00000593478 Chr7:63389966..63390180 AGTGAATCTGGCTGGTCTGC Chr7:63390022..63390041 60.42 55
downstream ENSMUSE00000593477 Chr7:63390401..63390533 TAACAGAAGACGGCCAACCT Chr7:63390508..63390527 59.73 50
downstream ENSMUSE00000593476 Chr7:63390640..63390767 TGAGTGAGCATTTTGCTTGG Chr7:63390765..63390784 59.99 45
downstream ENSMUSE00000593475 Chr7:63390856..63391051 AACAGCAGGCCTCAATTCAT Chr7:63390951..63390970 59.7 45
downstream ENSMUSE00000593474 Chr7:63391957..63392090 No primer for this exon
downstream ENSMUSE00000593473 Chr7:63392591..63392764 AAAGGCCCTGTACATTTTGC Chr7:63392672..63392691 59.09 45
downstream ENSMUSE00000593472 Chr7:63392839..63392975 CTTCCAGACGAACCTCTGCT Chr7:63392869..63392888 59.6 55
downstream ENSMUSE00000593471 Chr7:63393090..63393241 CAAGCATACAGCTTGCCAAA Chr7:63393185..63393204 60.01 45
downstream ENSMUSE00000593470 Chr7:63394149..63394340 CGGGTTCTCATTGGTAATGG Chr7:63394195..63394214 60.18 50
downstream ENSMUSE00000593469 Chr7:63401134..63401321 TGACCCTGGTTCCAATCTTC Chr7:63401292..63401311 59.9 50
downstream ENSMUSE00000593468 Chr7:63401907..63402099 CTCCACCAGCTTGAGGTCAT Chr7:63402047..63402066 60.26 55
downstream ENSMUSE00000593467 Chr7:63404009..63404191 TAACGCTGGTCAGCATCATC Chr7:63404068..63404087 59.83 50
downstream ENSMUSE00000593466 Chr7:63407813..63407994 TGAGCAGTGTGATCCACCTT Chr7:63407944..63407963 59.26 50
downstream ENSMUSE00000593465 Chr7:63408414..63408561 CCCATGATGGAAGAACTGCT Chr7:63408459..63408478 60.07 50
downstream ENSMUSE00000593464 Chr7:63408636..63408832 GTTGATGAGGCCATTCCACT Chr7:63408772..63408791 59.93 50
downstream ENSMUSE00000593463 Chr7:63409147..63409377 CACAGAACTGCACGGTGATT Chr7:63409336..63409355 59.75 50
downstream ENSMUSE00000593462 Chr7:63410385..63410523 AAAGCATAGGCTCCGTGAAA Chr7:63410442..63410461 59.85 45
downstream ENSMUSE00000593461 Chr7:63411757..63411900 CTGCCTCAGCTTGTCTTGGT Chr7:63411857..63411876 60.59 55
downstream ENSMUSE00000593460 Chr7:63412230..63412372 CAGGTGACATATCCCCAAGG Chr7:63412277..63412296 60.19 55
downstream ENSMUSE00000593459 Chr7:63412661..63412928 AACCAGATGCATTCCCAGAG Chr7:63412925..63412944 60.07 50
downstream ENSMUSE00000593458 Chr7:63413018..63413154 No primer for this exon
downstream ENSMUSE00000593457 Chr7:63414744..63414842 CAGGAAATCAGCACGCTTCT Chr7:63414803..63414822 60.54 50
downstream ENSMUSE00000593456 Chr7:63419112..63419280 ACTTTGCCCACATCACCTTC Chr7:63419179..63419198 59.97 50
downstream ENSMUSE00000593455 Chr7:63419379..63419504 AAGCCCCACACTTTGATGAG Chr7:63419500..63419519 60.11 50
downstream ENSMUSE00000593454 Chr7:63420285..63420393 AGGCACCAACTCCATTTCTG Chr7:63420376..63420395 60.11 50
downstream ENSMUSE00000593453 Chr7:63420508..63420647 GCTCATTAATCCTGCCGAAA Chr7:63420647..63420666 60.17 45
downstream ENSMUSE00000593452 Chr7:63424196..63424386 CGTTCAGGCTTTTCACCATT Chr7:63424309..63424328 60.11 45
downstream ENSMUSE00000593451 Chr7:63425756..63425861 TGTAGCTACTGTCCGCTGGAT Chr7:63425839..63425859 59.91 52.38
downstream ENSMUSE00000593450 Chr7:63425945..63426036 AGCAGGGGTACAGTGGTGTC Chr7:63426023..63426042 60.03 60
downstream ENSMUSE00000593449 Chr7:63433195..63433370 GAGACCGTGGATTTTGCAGT Chr7:63433269..63433288 60.12 50
downstream ENSMUSE00000593448 Chr7:63436439..63436550 CTTGTCATTCAGTCCCCACA Chr7:63436523..63436542 59.52 50
downstream ENSMUSE00000593447 Chr7:63437775..63437856 GAACCACATTCAGGGCAGAC Chr7:63437826..63437845 60.52 55
downstream ENSMUSE00000593446 Chr7:63437950..63438093 CTTGACCACGTAGCTGCTGA Chr7:63438077..63438096 60.2 55
downstream ENSMUSE00000593445 Chr7:63439312..63439402 ATCACCTTCACCCCATGAAA Chr7:63439376..63439395 60.17 45
downstream ENSMUSE00000593444 Chr7:63439676..63439853 AGTTCCCCACTGGATGTCAG Chr7:63439783..63439802 59.96 55
downstream ENSMUSE00000593443 Chr7:63439996..63440077 CTTCATCGGTCAGAGCCAGT Chr7:63440080..63440099 60.41 55
downstream ENSMUSE00000593442 Chr7:63440163..63440334 CCACACTCAATCTGGCACAC Chr7:63440289..63440308 60.16 55
downstream ENSMUSE00000593441 Chr7:63441205..63441349 GGCCCAGTCTGAAGTAGTCG Chr7:63441236..63441255 59.87 60
downstream ENSMUSE00000593440 Chr7:63443931..63444156 CTAGCGGGTCTCTTGCAGTC Chr7:63444144..63444163 60.16 60
downstream ENSMUSE00000593439 Chr7:63445174..63445345 GAAGAATCAGCATCCGAAGG Chr7:63445201..63445220 59.77 50
downstream ENSMUSE00000593438 Chr7:63446537..63446723 TGCCACAGATTTGGACTCAG Chr7:63446713..63446732 59.83 50
downstream ENSMUSE00000593437 Chr7:63447164..63447304 CATGGTTTCTGCAATGATGC Chr7:63447292..63447311 60.08 45
downstream ENSMUSE00000593436 Chr7:63449580..63449771 GCTCTGGGCCTGATGTTTTA Chr7:63449619..63449638 60.21 50
downstream ENSMUSE00000593435 Chr7:63452426..63452579 TGGTGGAGGTGTCGTCTGTA Chr7:63452561..63452580 60.15 55
downstream ENSMUSE00000199130 Chr7:63457471..63457578 CCTGTTGACACCATCCATGA Chr7:63457562..63457581 60.38 50
downstream ENSMUSE00000199136 Chr7:63459146..63459277 TCACTCGACCAGTCAGACCA Chr7:63459176..63459195 60.45 55
downstream ENSMUSE00000199157 Chr7:63459756..63459914 ATGAGAGGACACAGCGATCC Chr7:63459797..63459816 60.23 55
downstream ENSMUSE00000199111 Chr7:63460004..63460122 CCCAGCAGCCTGTTTATGTT Chr7:63460097..63460116 60.13 50
downstream ENSMUSE00000199153 Chr7:63460682..63460807 AGCTGTTTGCCACCTCTCAC Chr7:63460788..63460807 60.45 55
downstream ENSMUSE00000199121 Chr7:63461238..63461393 GAAACAGACGAGGCAATGGT Chr7:63461388..63461407 60.12 50
downstream ENSMUSE00000199148 Chr7:63461892..63462007 CATCCACTGCACAAGTTGCT Chr7:63462005..63462024 59.9 50
downstream ENSMUSE00000199114 Chr7:63462098..63462296 CCACCCATAAATGGTTCCAC Chr7:63462155..63462174 59.91 50
downstream ENSMUSE00000199085 Chr7:63463062..63463276 CAGCACCATAGCCAGTAGCA Chr7:63463089..63463108 60.03 55
downstream ENSMUSE00000199147 Chr7:63468191..63468368 TTTGCCCCATGTGTAGAGGT Chr7:63468314..63468333 60.38 50
downstream ENSMUSE00000199084 Chr7:63468812..63468973 GCCAAGCTTGCCATAGTCTC Chr7:63468940..63468959 59.99 55
downstream ENSMUSE00000199089 Chr7:63470723..63470814 TGGTAAGGGCGACAGAAAAC Chr7:63470795..63470814 60.11 50
downstream ENSMUSE00000199103 Chr7:63471217..63471356 AGGTCTTCGAACGTGGTCAT Chr7:63471277..63471296 59.58 50
downstream ENSMUSE00000199151 Chr7:63475075..63475262 GCAGCTACCAATCGTGGTCT Chr7:63475165..63475184 60.28 55
downstream ENSMUSE00000338975 Chr7:63475847..63476044 CGGTTCCGTAGAGCAATGAT Chr7:63475905..63475924 60.1 50
downstream ENSMUSE00000381132 Chr7:63478280..63478363 TCTCGCACCATAGTTGCTTG Chr7:63478326..63478345 60.01 50
downstream ENSMUSE00000282288 Chr7:63481889..63482030 CAGACTCGGTGAGGAAGGAG Chr7:63482016..63482035 59.98 60
downstream ENSMUSE00000282279 Chr7:63482208..63482402 GGGTGGCAGGGTTTAATAGG Chr7:63482369..63482388 60.55 55
downstream ENSMUSE00000282268 Chr7:63483172..63483284 CCAGCTGCTTCCATACAGGT Chr7:63483252..63483271 60.28 55
downstream ENSMUSE00000282257 Chr7:63483799..63483989 GCAGGCTCATAGCCTCAAAT Chr7:63483883..63483902 59.44 50
downstream ENSMUSE00000422902 Chr7:63484654..63484759 AGGTACAACTCGAGCCATCC Chr7:63484717..63484736 59.17 55
downstream ENSMUSE00000282231 Chr7:63485031..63485243 GAACCACTGGACCAAGGATG Chr7:63485126..63485145 60.36 55
downstream ENSMUSE00000342544 Chr7:63486230..63487166 AAGAGTCGGCGTCCTCATTA Chr7:63486464..63486483 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTTGTAATCGCCTTGCAG Chr7:63309364..63309384 59.33 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACTCCATTTGCGTGACTG Chr7:63309358..63309378 60.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030451