Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3993
Trapped Gene
Cyb5r4 (ENSMUSG00000032872)
Vector Insertion
Chr 9: 86924440 - 86927214
Public Clones AR0343 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000235696 (Chr9:86924339..86924439 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000235696 (Chr9:86924339..86924439 +)
Downstram Exon
ENSMUSE00000235675 (Chr9:86927215..86927296 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACCAGGCATTCTTTCAGCAT Chr9:86927264..86927283 59.7 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358616 Chr9:86916864..86917088 No primer for this exon
upstream ENSMUSE00000396544 Chr9:86921782..86921935 ATCCGACTGACCAAGAGTGG Chr9:86921818..86921837 60.11 55
upstream ENSMUSE00000694512 Chr9:86921809..86921935 ATCCGACTGACCAAGAGTGG Chr9:86921818..86921837 60.11 55
upstream ENSMUSE00000235696 Chr9:86924339..86924439 No primer for this exon

*** Putative Vector Insertion (Chr 9: 86924440 - 86927214) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235675 Chr9:86927215..86927296 ACCAGGCATTCTTTCAGCAT Chr9:86927264..86927283 59.7 45
downstream ENSMUSE00000235413 Chr9:86933561..86933590 No primer for this exon
downstream ENSMUSE00000235657 Chr9:86935217..86935301 GACATTTGGCTCTTGGGAAG Chr9:86935244..86935263 59.67 50
downstream ENSMUSE00000694536 Chr9:86935217..86935280 GACATTTGGCTCTTGGGAAG Chr9:86935244..86935263 59.67 50
downstream ENSMUSE00000694535 Chr9:86935327..86935355 GGGTTGTGCAGAACTGCTATC Chr9:86935350..86935370 59.76 52.38
downstream ENSMUSE00000694534 Chr9:86936072..86936145 No primer for this exon
downstream ENSMUSE00000235639 Chr9:86936088..86936145 No primer for this exon
downstream ENSMUSE00000235619 Chr9:86937615..86937708 AGTCATCCTGGAGGTCAACG Chr9:86937660..86937679 60.11 55
downstream ENSMUSE00000235604 Chr9:86942309..86942341 No primer for this exon
downstream ENSMUSE00000235582 Chr9:86943937..86944059 TCACCAAGACATTGCCAAGA Chr9:86944018..86944037 60.24 45
downstream ENSMUSE00000235553 Chr9:86950600..86950740 ATGTTGTCCAACTGGCACCT Chr9:86950718..86950737 60.43 50
downstream ENSMUSE00000235532 Chr9:86951977..86952129 CGATCAAGCTCTGGTGTGAA Chr9:86952121..86952140 59.98 50
downstream ENSMUSE00000235518 Chr9:86953760..86953910 CCTTCAGGTCCGCTTACAGA Chr9:86953793..86953812 60.39 55
downstream ENSMUSE00000235493 Chr9:86954200..86954286 No primer for this exon
downstream ENSMUSE00000235474 Chr9:86961484..86961648 GGTGCCGAGAGAACAAATTC Chr9:86961516..86961535 59.68 50
downstream ENSMUSE00000498721 Chr9:86971663..86972282 TTCACAAAACTGGACCACCA Chr9:86972180..86972199 59.98 45
downstream ENSMUSE00000694511 Chr9:86971663..86971717 TAAGCGGTGAATCCGTGAAT Chr9:86971719..86971738 60.47 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:86924490..86924510 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACGTTGTATGCGTGGACTT Chr9:86924462..86924483 60.05 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032872