Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3997
Trapped Gene
Melk (ENSMUSG00000035683)
Vector Insertion
Chr 4: 44357896 - 44359995
Public Clones AR0181 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000286720 (Chr4:44357785..44357895 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAAAGAATCTGAGCCTGGAA Chr4:44357785..44357805 59.94 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000286720 (Chr4:44357785..44357895 +)
Downstram Exon
ENSMUSE00000674557 (Chr4:44359996..44360227 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAAAGAATCTGAGCCTGGAA Chr4:44357785..44357805 59.94 42.86 ACTGGAATCTTCGGCTCAGA Chr4:44360165..44360184 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000286813 Chr4:44313822..44313944 TGTTCCGGCTTTGCTAGACT Chr4:44313854..44313873 60.01 50
upstream ENSMUSE00000286803 Chr4:44316443..44316538 No primer for this exon
upstream ENSMUSE00000286795 Chr4:44318904..44318989 CATGGATAAGAATGCGCTAGG Chr4:44318968..44318988 59.71 47.62
upstream ENSMUSE00000286783 Chr4:44319862..44319978 AGATCGATGCGCTGAAGAGT Chr4:44319887..44319906 60.13 50
upstream ENSMUSE00000286772 Chr4:44321778..44321921 GGGTCGTCTTCCGTCAGATA Chr4:44321845..44321864 60.07 55
upstream ENSMUSE00000286762 Chr4:44323162..44323230 No primer for this exon
upstream ENSMUSE00000286755 Chr4:44325036..44325128 CCTTGCTTATGCAGCTCCTG Chr4:44325074..44325093 61.06 55
upstream ENSMUSE00000714339 Chr4:44330896..44330994 ATGGGCATCCTCCTGTATGT Chr4:44330911..44330930 59.24 50
upstream ENSMUSE00000719937 Chr4:44330896..44330994 ATGGGCATCCTCCTGTATGT Chr4:44330911..44330930 59.24 50
upstream ENSMUSE00000286741 Chr4:44337072..44337140 TGGCTCTCTCCCAGTAGCAT Chr4:44337096..44337115 59.97 55
upstream ENSMUSE00000674542 Chr4:44337072..44337140 TGGCTCTCTCCCAGTAGCAT Chr4:44337096..44337115 59.97 55
upstream ENSMUSE00000674541 Chr4:44338513..44338611 ATTACAGCTGTCCCGTGGAG Chr4:44338574..44338593 60.13 55
upstream ENSMUSE00000711030 Chr4:44338513..44338611 ATTACAGCTGTCCCGTGGAG Chr4:44338574..44338593 60.13 55
upstream ENSMUSE00000714400 Chr4:44338513..44338611 ATTACAGCTGTCCCGTGGAG Chr4:44338574..44338593 60.13 55
upstream ENSMUSE00000286730 Chr4:44345752..44345838 AGGATTGCGTGACAGAGCTT Chr4:44345768..44345787 60.02 50
upstream ENSMUSE00000674558 Chr4:44345752..44345838 AGGATTGCGTGACAGAGCTT Chr4:44345768..44345787 60.02 50
upstream ENSMUSE00000286727 Chr4:44353498..44353617 GGCAGTACGATCACCTCACA Chr4:44353499..44353518 59.71 55
upstream ENSMUSE00000660800 Chr4:44353498..44353617 GGCAGTACGATCACCTCACA Chr4:44353499..44353518 59.71 55
upstream ENSMUSE00000286720 Chr4:44357785..44357895 TCAAAGAATCTGAGCCTGGAA Chr4:44357785..44357805 59.94 42.86
upstream ENSMUSE00000660799 Chr4:44357785..44357895 TCAAAGAATCTGAGCCTGGAA Chr4:44357785..44357805 59.94 42.86

*** Putative Vector Insertion (Chr 4: 44357896 - 44359995) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000286714 Chr4:44359996..44360227 ACTGGAATCTTCGGCTCAGA Chr4:44360165..44360184 59.95 50
downstream ENSMUSE00000674557 Chr4:44359996..44360227 ACTGGAATCTTCGGCTCAGA Chr4:44360165..44360184 59.95 50
downstream ENSMUSE00000286705 Chr4:44362716..44362812 GTGTTCTAACCGGGGCTTCT Chr4:44362757..44362776 60.5 55
downstream ENSMUSE00000674555 Chr4:44362716..44362812 GTGTTCTAACCGGGGCTTCT Chr4:44362757..44362776 60.5 55
downstream ENSMUSE00000286695 Chr4:44363814..44363982 TGAGATCCACGTCCATTGAA Chr4:44363842..44363861 60.05 45
downstream ENSMUSE00000674554 Chr4:44363814..44363982 TGAGATCCACGTCCATTGAA Chr4:44363842..44363861 60.05 45
downstream ENSMUSE00000286686 Chr4:44373744..44373847 CACCAGGCGAGTTGTAGTCA Chr4:44373779..44373798 59.9 55
downstream ENSMUSE00000674552 Chr4:44373744..44373847 CACCAGGCGAGTTGTAGTCA Chr4:44373779..44373798 59.9 55
downstream ENSMUSE00000286680 Chr4:44376582..44377154 ACAGTTGCCTTGGATTCAGC Chr4:44376956..44376975 60.26 50
downstream ENSMUSE00000674546 Chr4:44376582..44377154 ACAGTTGCCTTGGATTCAGC Chr4:44376956..44376975 60.26 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGCCACAGGTGGGTAGTTT Chr4:44357888..44357908 61.75 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGCCACAGGTGGGTAGTTT Chr4:44357888..44357908 61.75 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035683