Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4000
Trapped Gene
Ikbkap (ENSMUSG00000028431)
Vector Insertion
Chr 4: 56775776 - 56780686
Public Clones AR0157 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000179093 (Chr4:56780687..56780748 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCAGAGGAAGCACAGTGA Chr4:56780718..56780737 59.29 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000179093 (Chr4:56780687..56780748 -)
Downstram Exon
ENSMUSE00000179067 (Chr4:56775713..56775775 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCAGAGGAAGCACAGTGA Chr4:56780718..56780737 59.29 55 TTCCCAGGCAGATCCTTCTA Chr4:56775706..56775725 59.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349138 Chr4:56815031..56815169 CCCTTCAGTGGATCGTGTTT Chr4:56815112..56815131 59.97 50
upstream ENSMUSE00000328270 Chr4:56812847..56813009 AGAACGTGGACTGACGGAAG Chr4:56812867..56812886 60.3 55
upstream ENSMUSE00000328262 Chr4:56811530..56811682 TGCATTGTGGGTATTCAGGA Chr4:56811606..56811625 59.92 45
upstream ENSMUSE00000328253 Chr4:56809376..56809457 GGAGTGTGGCCAGTGGTATC Chr4:56809425..56809444 60.4 60
upstream ENSMUSE00000179097 Chr4:56808378..56808458 TTTGAAGTGATCGCAGAGGA Chr4:56808407..56808426 59.52 45
upstream ENSMUSE00000179091 Chr4:56806962..56807047 GGCAGTAAGCAGACCCAGTT Chr4:56807005..56807024 59.36 55
upstream ENSMUSE00000179083 Chr4:56805257..56805353 GGATGGGCAGTATTTTGCTG Chr4:56805281..56805300 60.47 50
upstream ENSMUSE00000179099 Chr4:56804899..56804989 CCTTGCAGTCAACCAGTGAG Chr4:56804934..56804953 59.46 55
upstream ENSMUSE00000179078 Chr4:56803760..56803883 CAAGATAAACCCAACCAGCAA Chr4:56803835..56803855 59.98 42.86
upstream ENSMUSE00000179069 Chr4:56803003..56803096 AGATTCCTCGGTGCTTGCTA Chr4:56803054..56803073 59.98 50
upstream ENSMUSE00000179059 Chr4:56800613..56800843 CGTGGGGAACTATCACTGGT Chr4:56800811..56800830 59.84 55
upstream ENSMUSE00000328203 Chr4:56799460..56799624 CGACGCCAGTAACCAGATTT Chr4:56799475..56799494 60.13 50
upstream ENSMUSE00000179073 Chr4:56797410..56797509 GCCAAACATGGATTCCACAG Chr4:56797483..56797502 61.31 50
upstream ENSMUSE00000328193 Chr4:56793898..56794089 ACCTGGGTTGAAGACGACAC Chr4:56794003..56794022 60.01 55
upstream ENSMUSE00000179077 Chr4:56792529..56792635 GGATGGAGTCGTCATTGGTT Chr4:56792601..56792620 59.79 50
upstream ENSMUSE00000179113 Chr4:56791831..56791934 ATGGAAGTAGCCACGATTGG Chr4:56791838..56791857 59.96 50
upstream ENSMUSE00000179071 Chr4:56789757..56789810 TGACTGACAGGTGTCGCTTT Chr4:56789775..56789794 59.47 50
upstream ENSMUSE00000179081 Chr4:56789562..56789667 TCTCCCTAAGTGGTGCCTCA Chr4:56789569..56789588 60.79 55
upstream ENSMUSE00000179057 Chr4:56788297..56788412 GAAATTCTGCGGAAAGTGGA Chr4:56788352..56788371 60.19 45
upstream ENSMUSE00000179105 Chr4:56787889..56787962 CTTGGCACAGATTCGGAAGT Chr4:56787899..56787918 60.26 50
upstream ENSMUSE00000179062 Chr4:56787560..56787638 GCATTTGAATGCATGAGGAA Chr4:56787603..56787622 59.63 40
upstream ENSMUSE00000179101 Chr4:56787394..56787473 No primer for this exon
upstream ENSMUSE00000179095 Chr4:56786071..56786208 ATGTACCCTCCCCCGATTAC Chr4:56786167..56786186 59.9 55
upstream ENSMUSE00000179060 Chr4:56785888..56785973 TGTGCTGCAGAAGGTACAGG Chr4:56785897..56785916 60.05 55
upstream ENSMUSE00000179089 Chr4:56785253..56785401 CACTCCCTTGGGACCTATGA Chr4:56785293..56785312 59.92 55
upstream ENSMUSE00000179087 Chr4:56784305..56784428 CCTTGGACACCTCAGCAAGT Chr4:56784308..56784327 60.3 55
upstream ENSMUSE00000179075 Chr4:56783853..56783950 ATCGTCCAGACTCACCACAG Chr4:56783859..56783878 58.67 55
upstream ENSMUSE00000179080 Chr4:56781886..56782087 CAGGAGAAGGCACTTGAAGC Chr4:56781984..56782003 60.13 55
upstream ENSMUSE00000179093 Chr4:56780687..56780748 GAGCAGAGGAAGCACAGTGA Chr4:56780718..56780737 59.29 55

*** Putative Vector Insertion (Chr 4: 56775776 - 56780686) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000179067 Chr4:56775713..56775775 TTCCCAGGCAGATCCTTCTA Chr4:56775706..56775725 59.77 50
downstream ENSMUSE00000179108 Chr4:56775121..56775181 TGGAAGGCTTTACACTGGTTT Chr4:56775108..56775128 58.75 42.86
downstream ENSMUSE00000179103 Chr4:56772673..56772786 CACCTGCAAGCGGTTTTTAT Chr4:56772691..56772710 60.13 45
downstream ENSMUSE00000179109 Chr4:56771836..56771947 CTGCTGGTTTCCGAGAAGAG Chr4:56771874..56771893 60.13 55
downstream ENSMUSE00000179079 Chr4:56771085..56771212 CCGACGGTTTTTAGATGACC Chr4:56771169..56771188 59.43 50
downstream ENSMUSE00000179070 Chr4:56769989..56770143 TCAAAATAGCACGCACCTCA Chr4:56770101..56770120 60.4 45
downstream ENSMUSE00000179074 Chr4:56768176..56768251 TGATGCTATTCGCAGTGGAG Chr4:56768196..56768215 59.97 50
downstream ENSMUSE00000328064 Chr4:56763646..56764591 GCACGAAGAGTGAGTGGACA Chr4:56764446..56764465 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTTGGGGTTTTGTTTGTTTT Chr4:56780697..56780719 59.65 27.27 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTTGGGGTTTTGTTTGTTTT Chr4:56780697..56780719 59.65 27.27 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028431