Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4014
Trapped Gene
Wapal (ENSMUSG00000041408)
Vector Insertion
Chr 14: 35508292 - 35535449
Public Clones (sanger) AQ1029 (sanger) RRH204 (baygenomics) E067H05 (ggtc) IST14490E12 (tigm)
IST14635D2 (tigm) IST11089B8 (tigm) IST14518D10 (tigm) IST12900C10 (tigm)
IST12445A12 (tigm) IST12001C10 (tigm) IST11845H6 (tigm) IST12022H4 (tigm)
IST10923F5 (tigm) IST12616A1 (tigm) IST10609H5 (tigm) IST14796C6 (tigm)
IST12339A4 (tigm) IST14555G1 (tigm) IST11439G10 (tigm) IST14840E5 (tigm)
IST14720B4 (tigm) IST15068B12 (tigm) IST14345A10 (tigm) IST12691C7 (tigm)
IST13396A5 (tigm) IST10434C4 (tigm) IST14624G9 (tigm) IST14331A1 (tigm)
IST14999G1 (tigm) IST14134D5 (tigm) IST13121E9 (tigm) IST12995F9 (tigm)
IST10740E5 (tigm) IST14036F6 (tigm) IST12425H12 (tigm) IST14677C12 (tigm)
IST13707H3 (tigm)
Private Clones OST430756 (lexicon) OST36725 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689490 (Chr14:35508173..35508291 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTTTAGTGGCCCCAAACG Chr14:35508271..35508290 61.06 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689490 (Chr14:35508173..35508291 +)
Downstram Exon
ENSMUSE00000689489 (Chr14:35535450..35535545 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTTTAGTGGCCCCAAACG Chr14:35508271..35508290 61.06 45 TTCTTCCGAGTCTGGATGGT Chr14:35535509..35535528 59.65 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000412292 Chr14:35487114..35487546 GCCCGAGCTTCCTATTTACC Chr14:35487364..35487383 60.06 55
upstream ENSMUSE00000689495 Chr14:35487150..35487247 AACTCCAGCGCTGACCATTC Chr14:35487179..35487198 62.68 55
upstream ENSMUSE00000561564 Chr14:35487528..35487546 No primer for this exon
upstream ENSMUSE00000617960 Chr14:35490140..35490660 TGGAGATCCCTTTGGTTTTG Chr14:35490368..35490387 59.9 45
upstream ENSMUSE00000710176 Chr14:35490140..35490660 TGGAGATCCCTTTGGTTTTG Chr14:35490368..35490387 59.9 45
upstream ENSMUSE00000330579 Chr14:35504868..35505920 AGTTGTGGGACCAGTTTTCG Chr14:35505419..35505438 60.01 50
upstream ENSMUSE00000689491 Chr14:35507523..35507632 GAGTGAGCCAAGGCAAGACT Chr14:35507608..35507627 59.6 55
upstream ENSMUSE00000330568 Chr14:35508173..35508291 ATTTTTAGTGGCCCCAAACG Chr14:35508271..35508290 61.06 45
upstream ENSMUSE00000689490 Chr14:35508173..35508291 ATTTTTAGTGGCCCCAAACG Chr14:35508271..35508290 61.06 45
upstream ENSMUSE00000689494 Chr14:35508191..35508291 ATTTTTAGTGGCCCCAAACG Chr14:35508271..35508290 61.06 45

*** Putative Vector Insertion (Chr 14: 35508292 - 35535449) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000330560 Chr14:35535450..35535545 TTCTTCCGAGTCTGGATGGT Chr14:35535509..35535528 59.65 50
downstream ENSMUSE00000689489 Chr14:35535450..35535545 TTCTTCCGAGTCTGGATGGT Chr14:35535509..35535528 59.65 50
downstream ENSMUSE00000330550 Chr14:35537892..35538044 CACTTTGAGTGGTGGTGCAG Chr14:35537969..35537988 60.35 55
downstream ENSMUSE00000689488 Chr14:35537892..35538044 CACTTTGAGTGGTGGTGCAG Chr14:35537969..35537988 60.35 55
downstream ENSMUSE00000330539 Chr14:35538314..35538450 TGAAGTGTTTCACGTGCTGA Chr14:35538350..35538369 59 45
downstream ENSMUSE00000689487 Chr14:35538314..35538450 TGAAGTGTTTCACGTGCTGA Chr14:35538350..35538369 59 45
downstream ENSMUSE00000330530 Chr14:35539086..35539197 TGCTGGGAATCATCCAAAGT Chr14:35539193..35539212 60.46 45
downstream ENSMUSE00000689486 Chr14:35539086..35539197 TGCTGGGAATCATCCAAAGT Chr14:35539193..35539212 60.46 45
downstream ENSMUSE00000330520 Chr14:35542366..35542593 TCTAGGCTGGCCCTATCAAG Chr14:35542451..35542470 59.43 55
downstream ENSMUSE00000330508 Chr14:35543735..35543846 AATCTCCTGCTCGTTTGGAA Chr14:35543795..35543814 59.81 45
downstream ENSMUSE00000330494 Chr14:35544695..35544795 TGCTCCCCATAATGAGGCTA Chr14:35544771..35544790 60.56 50
downstream ENSMUSE00000330481 Chr14:35546917..35546993 No primer for this exon
downstream ENSMUSE00000330469 Chr14:35549856..35550031 TCTCAGCACGGTTGTACTGC Chr14:35549908..35549927 60.06 55
downstream ENSMUSE00000330458 Chr14:35550457..35550572 TTCATCGCTGTGCCTATGAG Chr14:35550514..35550533 59.97 50
downstream ENSMUSE00000330450 Chr14:35551042..35551206 TGACAAGGCAGTGTCGATTC Chr14:35551105..35551124 59.84 50
downstream ENSMUSE00000330441 Chr14:35552417..35552624 CATGCTGAGTGGTAGGAGCA Chr14:35552504..35552523 60.01 55
downstream ENSMUSE00000330435 Chr14:35554243..35554331 GCTACGATGCAATCCTCCAT Chr14:35554288..35554307 60.07 50
downstream ENSMUSE00000330430 Chr14:35557995..35558090 No primer for this exon
downstream ENSMUSE00000394258 Chr14:35558811..35559403 TCAGCATTACCAAGCACCTG Chr14:35558916..35558935 59.86 50
downstream ENSMUSE00000561561 Chr14:35558811..35559043 ACGCAGAATGCATGATGAAG Chr14:35559043..35559062 59.83 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAAATAATCGCCTTGCAG Chr14:35520337..35520357 61.09 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTAACGTGACTGGGAAAA Chr14:35520337..35520357 59.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041408