Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4028
Trapped Gene
Cadm1 (ENSMUSG00000032076)
Vector Insertion
Chr 9: 47338339 - 47338589
Public Clones AQ0594 (sanger) (egtc) (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699721 (Chr9:47338340..47338588 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699721 (Chr9:47338340..47338588 +)
Downstram Exon
ENSMUSE00000468394 (Chr9:47338456..47338588 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50 GAAAGGAGCAACAGCAGGAG Chr9:47338568..47338587 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699728 Chr9:47338256..47338588 CAGCGCATCTCATTAGCATC Chr9:47338372..47338391 59.55 50

*** Putative Vector Insertion (Chr 9: 47338339 - 47338589) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699721 Chr9:47338340..47338588 GCTAATGAGATGCGCTGGAG Chr9:47338391..47338410 61.04 55
downstream ENSMUSE00000699740 Chr9:47338340..47338588 GCTAATGAGATGCGCTGGAG Chr9:47338391..47338410 61.04 55
downstream ENSMUSE00000468394 Chr9:47338456..47338588 GAAAGGAGCAACAGCAGGAG Chr9:47338568..47338587 60.13 55
downstream ENSMUSE00000699702 Chr9:47596050..47596200 GCTGGATCACTGAGTCGTCA Chr9:47596158..47596177 59.99 55
downstream ENSMUSE00000362801 Chr9:47596054..47596200 GCTGGATCACTGAGTCGTCA Chr9:47596158..47596177 59.99 55
downstream ENSMUSE00000535523 Chr9:47597780..47597932 TCTCCCTTCATCCGAGATTG Chr9:47597874..47597893 60.15 50
downstream ENSMUSE00000535518 Chr9:47605490..47605627 ACTGCCGTGTCTTTCTGGAT Chr9:47605538..47605557 59.73 50
downstream ENSMUSE00000467679 Chr9:47607455..47607613 CTAGATAGCGCTGGGTCTGC Chr9:47607607..47607626 60.14 60
downstream ENSMUSE00000473772 Chr9:47618127..47618226 GCCTTGCAGAGGGTAAGTCA Chr9:47618173..47618192 60.4 55
downstream ENSMUSE00000461284 Chr9:47621856..47622028 TAGTCCGAATGAGCCTTTCC Chr9:47622014..47622033 59.27 50
downstream ENSMUSE00000216272 Chr9:47626817..47626900 TGGGAGGAGGGATAGTTGTG Chr9:47626846..47626865 59.92 55
downstream ENSMUSE00000216271 Chr9:47637460..47637492 CGTGAACTGCTGGTTCTGTC Chr9:47637495..47637514 59.47 55
downstream ENSMUSE00000216275 Chr9:47656250..47656381 AAATAGCGGCCCAGAATGAT Chr9:47656370..47656389 60.79 45
downstream ENSMUSE00000488995 Chr9:47658355..47658473 ATAGCTGTGTCTGCGTCTGC Chr9:47658418..47658437 59.22 55
downstream ENSMUSE00000699718 Chr9:47658355..47659112 AGAAACTGGCAACAGGGAGA Chr9:47658977..47658996 59.84 50
downstream ENSMUSE00000699720 Chr9:47658355..47661463 AAACCCTTTCAACGACATGC Chr9:47660719..47660738 59.98 45
downstream ENSMUSE00000699727 Chr9:47658355..47661468 AAACCCTTTCAACGACATGC Chr9:47660719..47660738 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTGGTCGCTCCTGACTCC Chr9:47338348..47338368 62.14 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGCCGTGACTGGGAAAAC Chr9:47338385..47338405 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032076