Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4052
Trapped Gene
Ubac2 (ENSMUSG00000041765)
Vector Insertion
Chr 14: 122393693 - 122408012
Public Clones AQ0316 (sanger)
Private Clones OST197587 (lexicon) OST59512 (lexicon) OST59249 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000356071 (Chr14:122393447..122393692 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGTGCTATGACCGCAAAG Chr14:122393455..122393474 60.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000356071 (Chr14:122393447..122393692 +)
Downstram Exon
ENSMUSE00000226438 (Chr14:122408013..122408135 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGTGCTATGACCGCAAAG Chr14:122393455..122393474 60.28 50 CGGTTCCAATTGATCATTCC Chr14:122408038..122408057 60.13 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482899 Chr14:122277828..122277996 No primer for this exon
upstream ENSMUSE00000433942 Chr14:122304345..122304472 CATGCTGTCAAGCACGACTT Chr14:122304449..122304468 60.06 50
upstream ENSMUSE00000433902 Chr14:122306513..122306632 GAGGCTGATATGCGGAAGAA Chr14:122306518..122306537 60.32 50
upstream ENSMUSE00000433896 Chr14:122307433..122307542 GCAGTATTCGCTTGGTGTCA Chr14:122307495..122307514 59.87 50
upstream ENSMUSE00000433888 Chr14:122372831..122372954 CCGTGTTCGCTCTCTTTGTT Chr14:122372839..122372858 60.43 50
upstream ENSMUSE00000433877 Chr14:122382490..122382537 CCTCTGGGTCCTACATCTGG Chr14:122382497..122382516 59.53 60
upstream ENSMUSE00000356071 Chr14:122393447..122393692 CATGTGCTATGACCGCAAAG Chr14:122393455..122393474 60.28 50

*** Putative Vector Insertion (Chr 14: 122393693 - 122408012) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000226438 Chr14:122408013..122408135 CGGTTCCAATTGATCATTCC Chr14:122408038..122408057 60.13 45
downstream ENSMUSE00000433856 Chr14:122419172..122420256 CGGGCACATCACTGTCATAC Chr14:122419314..122419333 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr14:122405744..122405764 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGTGTCGTGACTGGGAAA Chr14:122402737..122402757 60.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041765