Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4063
Trapped Gene
Ccdc15 (ENSMUSG00000034303)
Vector Insertion
Chr 9: 37151619 - 37155322
Public Clones AP1021 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376693 (Chr9:37155323..37155508 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAATACCAGTTGGGGCTTGG Chr9:37155365..37155384 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376693 (Chr9:37155323..37155508 -)
Downstram Exon
ENSMUSE00000223921 (Chr9:37151469..37151618 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAATACCAGTTGGGGCTTGG Chr9:37155365..37155384 59.82 50 TCTTGCTTTCTTCGTTGCTG Chr9:37151541..37151560 59.34 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637912 Chr9:37155619..37155977 CTCCAGGCTTCACAGGTCTC Chr9:37155848..37155867 59.99 60
upstream ENSMUSE00000376693 Chr9:37155323..37155508 TAATACCAGTTGGGGCTTGG Chr9:37155365..37155384 59.82 50

*** Putative Vector Insertion (Chr 9: 37151619 - 37155322) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000223921 Chr9:37151469..37151618 TCTTGCTTTCTTCGTTGCTG Chr9:37151541..37151560 59.34 45
downstream ENSMUSE00000223908 Chr9:37150021..37150206 AAACCTTCCAACAGCAGCAT Chr9:37150077..37150096 59.74 45
downstream ENSMUSE00000224224 Chr9:37127982..37128095 GGTGACGTGCCTGTTTCATA Chr9:37128043..37128062 59.57 50
downstream ENSMUSE00000344794 Chr9:37123993..37124112 GAAATTTTCCCACAGCCAAG Chr9:37124068..37124087 59.55 45
downstream ENSMUSE00000224140 Chr9:37122744..37123472 GGCTTCCAGCTCAGTATTGC Chr9:37123109..37123128 59.99 55
downstream ENSMUSE00000379756 Chr9:37121872..37121937 TTCTCTCCCTTTCCCATCTGT Chr9:37121862..37121882 60.06 47.62
downstream ENSMUSE00000356171 Chr9:37120962..37121084 TCTGAGGTGGAGCACACTGA Chr9:37120969..37120988 60.61 55
downstream ENSMUSE00000351935 Chr9:37118903..37119013 TGTCCTAACAGAGGGCTGCT Chr9:37118968..37118987 60.01 55
downstream ENSMUSE00000384230 Chr9:37111895..37111990 CCCGACCGATACTCCTCATA Chr9:37111943..37111962 59.91 55
downstream ENSMUSE00000335669 Chr9:37110465..37110568 CCTCCTCTTTCGTTCCCTTT Chr9:37110451..37110470 59.69 50
downstream ENSMUSE00000369019 Chr9:37087159..37087335 TGCTCTTCAGCATAGCGTTG Chr9:37087272..37087291 60.3 50
downstream ENSMUSE00000701587 Chr9:37086552..37086700 TGTTGGCACAGGTATCAGGA Chr9:37086557..37086576 60.11 50
downstream ENSMUSE00000701586 Chr9:37084943..37085066 TGGAGTCCGTCTATGTGCAG Chr9:37084935..37084954 59.85 55
downstream ENSMUSE00000701585 Chr9:37083420..37084150 TTGCCCTCATTGGGTTTAAG Chr9:37083619..37083638 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGCACATGTGAGTGTCAGT Chr9:37155309..37155330 59.8 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGCACATGTGAGTGTCAGT Chr9:37155309..37155330 59.8 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034303