Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4064
Trapped Gene
Pi4ka (ENSMUSG00000041720)
Vector Insertion
Chr 16: 17348859 - 17350854
Public Clones AP1020 (sanger) AP0919 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000276446 (Chr16:17350855..17351023 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACATTGCAGCCAACATTCA Chr16:17350970..17350989 60.12 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000276446 (Chr16:17350855..17351023 -)
Downstram Exon
ENSMUSE00000277320 (Chr16:17348808..17348858 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACATTGCAGCCAACATTCA Chr16:17350970..17350989 60.12 40 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000474011 Chr16:17406348..17406407 No primer for this exon
upstream ENSMUSE00000276557 Chr16:17389434..17389550 GATTGCATTGGGCATTTTTC Chr16:17389454..17389473 60.28 40
upstream ENSMUSE00000276548 Chr16:17386329..17386422 AGAAAGCACAGCTCGGAAAG Chr16:17386335..17386354 59.76 50
upstream ENSMUSE00000276538 Chr16:17381894..17381982 CTGGTGACCTTGCTGTCTGA Chr16:17381928..17381947 60.02 55
upstream ENSMUSE00000276530 Chr16:17378535..17378607 GAGGCAATTTTGCAGGTTTT Chr16:17378582..17378601 59.21 40
upstream ENSMUSE00000276521 Chr16:17377011..17377270 ATGACTTTCGCTCCATCCTG Chr16:17377086..17377105 60.22 50
upstream ENSMUSE00000276512 Chr16:17373443..17373509 TAGCCCAGAACGTGGCATAC Chr16:17373488..17373507 61.05 55
upstream ENSMUSE00000276505 Chr16:17367497..17367645 GGAAATGCTTCGGGAACTCT Chr16:17367505..17367524 60.58 50
upstream ENSMUSE00000276496 Chr16:17364040..17364105 GAGGAGCCTGTTCTCAAATCC Chr16:17364070..17364090 60.21 52.38
upstream ENSMUSE00000276487 Chr16:17360590..17360686 TTCAGTGATCCCCTGTACCTG Chr16:17360633..17360653 59.97 52.38
upstream ENSMUSE00000276479 Chr16:17358988..17359179 TGGAGCAGTTCAACATGAGC Chr16:17359118..17359137 59.99 50
upstream ENSMUSE00000277361 Chr16:17358380..17358480 TGAAAAGCTGCAGTCCAAGA Chr16:17358433..17358452 59.72 45
upstream ENSMUSE00000277349 Chr16:17357639..17357768 CAGTGACGCCATCTTTGAGA Chr16:17357706..17357725 59.98 50
upstream ENSMUSE00000276468 Chr16:17356177..17356309 CAATGAGCATTCCGAGTCAA Chr16:17356259..17356278 59.8 45
upstream ENSMUSE00000277340 Chr16:17354964..17355059 TCCAACCGGCTCTACATTTC Chr16:17354979..17354998 60.07 50
upstream ENSMUSE00000276459 Chr16:17354143..17354326 TTTGAGGGACACTCCAAAGG Chr16:17354250..17354269 60.08 50
upstream ENSMUSE00000276452 Chr16:17352831..17352934 No primer for this exon
upstream ENSMUSE00000276446 Chr16:17350855..17351023 AACATTGCAGCCAACATTCA Chr16:17350970..17350989 60.12 40

*** Putative Vector Insertion (Chr 16: 17348859 - 17350854) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000277320 Chr16:17348808..17348858 No primer for this exon
downstream ENSMUSE00000276774 Chr16:17326034..17326142 ACAGCGAATCCCATTAGCAC Chr16:17326023..17326042 60.1 50
downstream ENSMUSE00000276440 Chr16:17325487..17325623 AGGGGTGACCGTATCGTTTT Chr16:17325465..17325484 60.61 50
downstream ENSMUSE00000276435 Chr16:17325206..17325339 CTTGTTGATGAGGGCAGACA Chr16:17325240..17325259 59.83 50
downstream ENSMUSE00000276755 Chr16:17323081..17323163 TTACCTGGAAGCGATCTGGA Chr16:17323104..17323123 60.73 50
downstream ENSMUSE00000276750 Chr16:17318576..17318646 TCAGCAACAGCAATGACACA Chr16:17318594..17318613 60.03 45
downstream ENSMUSE00000276746 Chr16:17318373..17318497 TTCACCAGCAGAAACTGTGC Chr16:17318417..17318436 60.03 50
downstream ENSMUSE00000276739 Chr16:17317387..17317468 AGTGACAGGGTCTGCAGGAT Chr16:17317378..17317397 59.71 55
downstream ENSMUSE00000276732 Chr16:17317055..17317138 CAGGAACCGTGATCCGATAG Chr16:17317053..17317072 60.47 55
downstream ENSMUSE00000276728 Chr16:17315642..17315731 GGCTTCCTGTAGGATCATTCC Chr16:17315659..17315679 59.92 52.38
downstream ENSMUSE00000276724 Chr16:17312445..17312564 CCAATCCTGTGTGCTGAGAC Chr16:17312485..17312504 59.26 55
downstream ENSMUSE00000276428 Chr16:17309399..17309491 TCAAGGATGCCATGAAGTTG Chr16:17309403..17309422 59.65 45
downstream ENSMUSE00000276706 Chr16:17308159..17308315 GCACCTGAGAACCGAATCAT Chr16:17308265..17308284 60.08 50
downstream ENSMUSE00000276702 Chr16:17307796..17307923 GGCTAGTGCAGTCTCCATGC Chr16:17307819..17307838 60.98 60
downstream ENSMUSE00000276694 Chr16:17303378..17303536 GGTCTTGGCTGACTTGCTTC Chr16:17303396..17303415 60 55
downstream ENSMUSE00000276689 Chr16:17303084..17303235 TCCACCTGGTCAGAGCTACA Chr16:17303161..17303180 59.42 55
downstream ENSMUSE00000276681 Chr16:17301086..17301193 CATTTGGAACCACATCAGCA Chr16:17301122..17301141 60.52 45
downstream ENSMUSE00000276675 Chr16:17299535..17299662 GGCTGGCAGTCAGGTACTTC Chr16:17299528..17299547 59.87 60
downstream ENSMUSE00000276421 Chr16:17297644..17297763 GGGTAGCCTGTTGTCGAGAG Chr16:17297682..17297701 59.87 60
downstream ENSMUSE00000276664 Chr16:17297303..17297382 CAGTGTCCTGCGTTTCATGT Chr16:17297296..17297315 59.75 50
downstream ENSMUSE00000276655 Chr16:17296989..17297182 AGTGATGAGGCGTTCGATCT Chr16:17297134..17297153 59.83 50
downstream ENSMUSE00000276651 Chr16:17295465..17295555 CGAGACGGGTCACTTCATTT Chr16:17295490..17295509 60.11 50
downstream ENSMUSE00000276648 Chr16:17293936..17294103 CGCAGGACTTTTACCCCATA Chr16:17293927..17293946 59.95 50
downstream ENSMUSE00000276644 Chr16:17292973..17293026 GCACAATCTGGGGGATGTAG Chr16:17292971..17292990 60.34 55
downstream ENSMUSE00000276639 Chr16:17291208..17291328 TTCTGGTGCCCTTCTTCATC Chr16:17291191..17291210 60.19 50
downstream ENSMUSE00000276634 Chr16:17286745..17286874 GATGATGGCTGACACGTTTG Chr16:17286725..17286744 60.12 50
downstream ENSMUSE00000276632 Chr16:17285300..17285370 TTCATCGCCTTTAGGGTAGG Chr16:17285327..17285346 59.18 50
downstream ENSMUSE00000276626 Chr16:17284689..17284761 TCTAGCACGATTGCTTCAGG Chr16:17284700..17284719 59.17 50
downstream ENSMUSE00000276619 Chr16:17284540..17284610 CACTCCGCATCTCTTCACCT Chr16:17284537..17284556 60.41 55
downstream ENSMUSE00000276614 Chr16:17283393..17283502 CATTCATCCTCTGCGTCTGA Chr16:17283447..17283466 59.94 50
downstream ENSMUSE00000276608 Chr16:17282916..17283020 GCCACTACCCGATAAGGAAA Chr16:17282907..17282926 59.04 50
downstream ENSMUSE00000276603 Chr16:17282710..17282835 ATCCCCATACTGGCGTGTAA Chr16:17282712..17282731 60.21 50
downstream ENSMUSE00000276596 Chr16:17282379..17282499 TTGTGCCTGTCCTTGATCTG Chr16:17282401..17282420 59.83 50
downstream ENSMUSE00000276590 Chr16:17281942..17282101 AACCTCGGACACACATCTCC Chr16:17281933..17281952 59.97 55
downstream ENSMUSE00000276414 Chr16:17281113..17281202 GGGAGACGACTGCATCCATA Chr16:17281155..17281174 61.04 55
downstream ENSMUSE00000276407 Chr16:17280810..17280893 TGCTGAGGAAACAGTTCTGG Chr16:17280792..17280811 59.01 50
downstream ENSMUSE00000562428 Chr16:17280445..17280713 CAAACGGAATGTGTCCAGTG Chr16:17280499..17280518 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGGAGATGCATTTCGAG Chr16:17350829..17350849 59.77 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGGAGATGCATTTCGAG Chr16:17350829..17350849 59.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041720