Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4069
Trapped Gene
2310008H04Rik (ENSMUSG00000041974)
Vector Insertion
Chr 16: 16073314 - 16114919
Public Clones (sanger) (sanger) AP0886 (sanger) (sanger) RRQ067 (baygenomics) E049H07 (ggtc)
(ggtc) D092A04 (ggtc) (ggtc) M120E05 (ggtc) 3SE167B04 (ggtc) D073G10 (ggtc)
(ggtc) IST11513C2 (tigm) IST14724H6 (tigm) IST14074F6 (tigm) IST14774H6 (tigm)
IST15063F3 (tigm) IST14774H6 (tigm) IST10188E10 (tigm) IST13090B3 (tigm)
IST10221B4 (tigm) IST12893H12 (tigm) IST11513C2 (tigm) IST10260A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459078 (Chr16:16114920..16115074 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGATCCTGGTGGGCCTAGT Chr16:16115013..16115032 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459078 (Chr16:16114920..16115074 -)
Downstram Exon
ENSMUSE00000704057 (Chr16:16073245..16073313 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGATCCTGGTGGGCCTAGT Chr16:16115013..16115032 59.96 55 TTTAGGAGACCTGGGGGAAC Chr16:16073236..16073255 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459117 Chr16:16146838..16146944 TGCACGTAGGAGATGTCTGG Chr16:16146863..16146882 59.85 55
upstream ENSMUSE00000459097 Chr16:16140801..16140956 TGAGACGGGGAAATTTCAAG Chr16:16140879..16140898 60.04 45
upstream ENSMUSE00000459090 Chr16:16140099..16140165 No primer for this exon
upstream ENSMUSE00000459083 Chr16:16118900..16119076 TGTCCCGAAGACGAAGACAT Chr16:16118905..16118924 60.66 50
upstream ENSMUSE00000459078 Chr16:16114920..16115074 AAGATCCTGGTGGGCCTAGT Chr16:16115013..16115032 59.96 55

*** Putative Vector Insertion (Chr 16: 16073314 - 16114919) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000704057 Chr16:16073245..16073313 TTTAGGAGACCTGGGGGAAC Chr16:16073236..16073255 60.3 55
downstream ENSMUSE00000459069 Chr16:16053359..16053609 AAATCCGCCTGGTATTTGTG Chr16:16053478..16053497 59.82 45
downstream ENSMUSE00000459063 Chr16:16048097..16048197 TTCGATTCTGCAGTTCTTGG Chr16:16048135..16048154 59 45
downstream ENSMUSE00000459056 Chr16:16037583..16037802 TGCATTCCTCATGCAGTTCT Chr16:16037727..16037746 59.4 45
downstream ENSMUSE00000459048 Chr16:15968621..15968810 ATAGGTCTTCGCGCACTGTT Chr16:15968691..15968710 59.9 50
downstream ENSMUSE00000459041 Chr16:15966695..15966945 CCTGACTCCAGACCATAGGC Chr16:15966774..15966793 59.68 60
downstream ENSMUSE00000382433 Chr16:15936646..15936786 TCAAGAACACTTCCCCGAAC Chr16:15936712..15936731 60.09 50
downstream ENSMUSE00000280731 Chr16:15915393..15915480 AACTGAAGAGCCCTGGTGTC Chr16:15915439..15915458 59.31 55
downstream ENSMUSE00000280729 Chr16:15912762..15912902 TTGTCCCAGTGTTGGATGTG Chr16:15912815..15912834 60.42 50
downstream ENSMUSE00000280724 Chr16:15912612..15912671 TGCAACGTGTACTGCACTCAT Chr16:15912625..15912645 60.39 47.62
downstream ENSMUSE00000280719 Chr16:15904150..15904354 TCCTTAAAAGCGTCCCTGAA Chr16:15904133..15904152 59.82 45
downstream ENSMUSE00000280715 Chr16:15903002..15903148 GGGCACTCAGTTCATCCAGT Chr16:15903013..15903032 60.12 55
downstream ENSMUSE00000280709 Chr16:15897317..15897410 ACACACAGGCCACGAGAAAG Chr16:15897339..15897358 61.31 55
downstream ENSMUSE00000280703 Chr16:15895619..15895733 CTCAGGTCTCGTGGGACAGT Chr16:15895615..15895634 60.31 60
downstream ENSMUSE00000280694 Chr16:15895236..15895289 TCAGAGGCAGCAGACATCAG Chr16:15895221..15895240 60.29 55
downstream ENSMUSE00000352936 Chr16:15889320..15889878 AAGCCCAAGTAGCTGCAAAA Chr16:15889465..15889484 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGTTTTAATCGCCTTGCAG Chr16:16108854..16108875 59.27 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGCGTGACTGGGAAAACC Chr16:16108852..16108872 62.78 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTTCCTTTGGAACGATTTTG Chr16:16100103..16100124 59.08 33.33 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGACAAAGAAGATCCCGTGAC Chr16:16109018..16109039 60.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041974