Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI408
Trapped Gene
Phf16 (ENSMUSG00000037315)
Vector Insertion
Chr X: 20067019 - 20071282
Public Clones GC1451 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326519 (ChrX:20066828..20067018 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATCTACATGCCGCTATGA ChrX:20066940..20066959 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326519 (ChrX:20066828..20067018 +)
Downstram Exon
ENSMUSE00000326510 (ChrX:20071283..20071494 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATCTACATGCCGCTATGA ChrX:20066940..20066959 59.82 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656600 ChrX:20002928..20002956 No primer for this exon
upstream ENSMUSE00000483919 ChrX:20006149..20006257 TGCTGAGTCATTGGGAAAAA ChrX:20006200..20006219 59.25 40
upstream ENSMUSE00000484829 ChrX:20012337..20012424 GGAGTGGCCAAGATCTACCA ChrX:20012360..20012379 60.07 55
upstream ENSMUSE00000326534 ChrX:20037642..20037698 CACCATGATGAAACGGCATA ChrX:20037646..20037665 60.34 45
upstream ENSMUSE00000326530 ChrX:20039238..20039317 No primer for this exon
upstream ENSMUSE00000326524 ChrX:20056640..20056797 GACCTCATCAGTGCCATGAA ChrX:20056652..20056671 59.64 50
upstream ENSMUSE00000326519 ChrX:20066828..20067018 GCATCTACATGCCGCTATGA ChrX:20066940..20066959 59.82 50

*** Putative Vector Insertion (Chr X: 20067019 - 20071282) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000326510 ChrX:20071283..20071494 No primer for this exon
downstream ENSMUSE00000326505 ChrX:20076552..20076719 TCCCTGTTCTGGTGGTCTTC ChrX:20076681..20076700 60.09 55
downstream ENSMUSE00000326497 ChrX:20079522..20079638 CCCCTGTCTTCAACTTGCAC ChrX:20079630..20079649 60.69 55
downstream ENSMUSE00000326487 ChrX:20088146..20088616 TCTCATCCGAGTGTGAATGC ChrX:20088586..20088605 59.79 50
downstream ENSMUSE00000326478 ChrX:20089862..20089979 TCTGTTCCTGCACTTTGGTG ChrX:20089937..20089956 59.87 50
downstream ENSMUSE00000370428 ChrX:20094112..20097063 GAATGGCTTCGGCTAGTCTG ChrX:20094388..20094407 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAATTTTAATCGCCTTGC ChrX:20070062..20070082 60.04 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTTGGAATTTCGTGACTGG ChrX:20070058..20070079 59.09 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037315