Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4083
Trapped Gene
Zmat3 (ENSMUSG00000027663)
Vector Insertion
Chr 3: 32244503 - 32259811
Public Clones AP0599 (sanger) P007D12 (ggtc)
Private Clones OST450623 (lexicon) OST192785 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273004 (Chr3:32259812..32260138 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTAATCGGCCTTCAACCT Chr3:32260030..32260049 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273004 (Chr3:32259812..32260138 -)
Downstram Exon
ENSMUSE00000171896 (Chr3:32244380..32244502 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTAATCGGCCTTCAACCT Chr3:32260030..32260049 59.96 50 GGACAGCTGTTAGCTGCGTA Chr3:32244428..32244447 59.25 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676063 Chr3:32264426..32264587 CGACCGACTTTTGACAATCA Chr3:32264532..32264551 59.69 45
upstream ENSMUSE00000273004 Chr3:32259812..32260138 ACCTAATCGGCCTTCAACCT Chr3:32260030..32260049 59.96 50

*** Putative Vector Insertion (Chr 3: 32244503 - 32259811) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171896 Chr3:32244380..32244502 GGACAGCTGTTAGCTGCGTA Chr3:32244428..32244447 59.25 55
downstream ENSMUSE00000171893 Chr3:32242474..32242640 GGAGTCTCTTGGCATGGTTC Chr3:32242483..32242502 59.66 55
downstream ENSMUSE00000171898 Chr3:32242256..32242356 ACTCCCTTCTTTCCGAGTCC Chr3:32242289..32242308 59.68 55
downstream ENSMUSE00000592911 Chr3:32233714..32240617 CGCCTACACGTCCCTAACAT Chr3:32238201..32238220 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTTAAGGTAATCGCCTTGC Chr3:32253748..32253770 59.77 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTAAGGCGTGACTGGGAAA Chr3:32253747..32253767 60.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027663