Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4114
Trapped Gene
Mtap1b (ENSMUSG00000052727)
Vector Insertion
Chr 13: 100195917 - 100197173
Public Clones AN0613 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000498887 (Chr13:100197174..100197412 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATTCCCAACCACAGCAACA Chr13:100197320..100197339 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000498887 (Chr13:100197174..100197412 -)
Downstram Exon
ENSMUSE00000504699 (Chr13:100194396..100195916 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATTCCCAACCACAGCAACA Chr13:100197320..100197339 59.96 45 GGCTGCGGTCTCTACAGTTC Chr13:100195728..100195747 60.02 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514152 Chr13:100286259..100286495 GAGACCGTAACCGAAGAGCA Chr13:100286291..100286310 60.4 55
upstream ENSMUSE00000519850 Chr13:100278063..100278164 GCAACTTGGACCAGGAACTC Chr13:100278112..100278131 59.7 55
upstream ENSMUSE00000511825 Chr13:100214169..100214251 TCGTTCTGATCAACCCTTCA Chr13:100214190..100214209 59.22 45
upstream ENSMUSE00000471664 Chr13:100211589..100211729 CCATAAACTGCTGGTGCTCA Chr13:100211681..100211700 59.86 50
upstream ENSMUSE00000510765 Chr13:100199167..100205656 AAAAAGTGCAGAGCCTGGAA Chr13:100200857..100200876 59.99 45
upstream ENSMUSE00000498887 Chr13:100197174..100197412 TATTCCCAACCACAGCAACA Chr13:100197320..100197339 59.96 45

*** Putative Vector Insertion (Chr 13: 100195917 - 100197173) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000504699 Chr13:100194396..100195916 GGCTGCGGTCTCTACAGTTC Chr13:100195728..100195747 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGTCTGAGGTGCATTTG Chr13:100197138..100197158 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGTCTGAGGTGCATTTG Chr13:100197138..100197158 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052727