Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4156
Trapped Gene
Ranbp9 (ENSMUSG00000038546)
Vector Insertion
Chr 13: 43520584 - 43525816
Public Clones AM0815 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000440634 (Chr13:43525817..43525839 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000440634 (Chr13:43525817..43525839 -)
Downstram Exon
ENSMUSE00000440626 (Chr13:43520399..43520583 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGTTCTCCATTCTCGCATGT Chr13:43520448..43520467 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682942 Chr13:43576247..43576342 AAGCAGGGACGAGTGGAGGT Chr13:43576322..43576341 63.47 60
upstream ENSMUSE00000367206 Chr13:43575781..43576075 TTCAGCTACATCGGCCTCTC Chr13:43575810..43575829 60.5 55
upstream ENSMUSE00000571097 Chr13:43557081..43557192 TCATGGTAAAACCCCCAAAG Chr13:43557172..43557191 59.66 45
upstream ENSMUSE00000286270 Chr13:43531459..43531511 TGGGAATTGGTCTTTCTGCT Chr13:43531487..43531506 59.67 45
upstream ENSMUSE00000440638 Chr13:43530183..43530350 TGGTGATGTCATTGGCTGTT Chr13:43530237..43530256 59.97 45
upstream ENSMUSE00000440634 Chr13:43525817..43525839 No primer for this exon

*** Putative Vector Insertion (Chr 13: 43520584 - 43525816) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000440626 Chr13:43520399..43520583 GGTTCTCCATTCTCGCATGT Chr13:43520448..43520467 60.08 50
downstream ENSMUSE00000286233 Chr13:43517920..43518032 No primer for this exon
downstream ENSMUSE00000286227 Chr13:43516580..43516688 CATTCGTCCTGCTAACACCA Chr13:43516635..43516654 59.72 50
downstream ENSMUSE00000286218 Chr13:43514945..43515135 GTCGAGGACTGACGGGATAA Chr13:43515010..43515029 60.07 55
downstream ENSMUSE00000440613 Chr13:43511694..43511838 TGGCAATATGATTGGTGTGC Chr13:43511759..43511778 60.35 45
downstream ENSMUSE00000440609 Chr13:43509352..43509473 CCATTTCGGTGTCACAATCTT Chr13:43509330..43509350 59.85 42.86
downstream ENSMUSE00000440447 Chr13:43507780..43507931 TTGTAGCTCTCGGCCAAAGT Chr13:43507821..43507840 60.01 50
downstream ENSMUSE00000440439 Chr13:43501981..43502092 TCCAAGGATCCGAATATGCT Chr13:43502034..43502053 59.49 45
downstream ENSMUSE00000616104 Chr13:43498748..43499058 AAATGCACAGGACCCAACTC Chr13:43498933..43498952 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGAAGTTAATCGCCTTGCAG Chr13:43522751..43522773 59.92 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTCGTGACTGGGAAAACC Chr13:43522749..43522769 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038546