Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI416
Trapped Gene
Vapa (ENSMUSG00000024091)
Vector Insertion
Chr 17: 65944395 - 65962559
Public Clones GC1469 (tigem) YTA140 (baygenomics) XG054 (baygenomics) YTA204 (baygenomics)
RRY414 (baygenomics) A016A03 (ggtc) A020B01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306239 (Chr17:65962560..65962836 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGACCCTCCTTCAGACCT Chr17:65962571..65962590 60.78 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306239 (Chr17:65962560..65962836 -)
Downstram Exon
ENSMUSE00000540917 (Chr17:65944242..65944394 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGACCCTCCTTCAGACCT Chr17:65962571..65962590 60.78 60 GGCGAGGTGCTGTAGTCTTC Chr17:65944280..65944299 60.02 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000306239 Chr17:65962560..65962836 CTCGACCCTCCTTCAGACCT Chr17:65962571..65962590 60.78 60

*** Putative Vector Insertion (Chr 17: 65944395 - 65962559) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000540917 Chr17:65944242..65944394 GGCGAGGTGCTGTAGTCTTC Chr17:65944280..65944299 60.02 60
downstream ENSMUSE00000138298 Chr17:65942780..65942883 CTGAAATGTTTGGTGGAGCA Chr17:65942772..65942791 59.69 45
downstream ENSMUSE00000138302 Chr17:65941631..65941711 TTCATTCGGCATTTCAAACA Chr17:65941621..65941640 60.05 35
downstream ENSMUSE00000138301 Chr17:65931920..65932093 AGTCGCTTGCACTCTTCCAT Chr17:65931944..65931963 60.02 50
downstream ENSMUSE00000381941 Chr17:65929396..65930187 CCAGGTTTATCCGAATGTGC Chr17:65930119..65930138 60.33 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGATAATCGCCTTGCAGCAC Chr17:65956491..65956512 62.16 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCCTGCCTGTCTTTTCAC Chr17:65956507..65956527 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024091