Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4161
Trapped Gene
Cep57 (ENSMUSG00000031922)
Vector Insertion
Chr 9: 13617965 - 13620498
Public Clones AM0798 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214669 (Chr9:13620499..13620576 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGTCCAAACTCCGTGAAG Chr9:13620540..13620559 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214669 (Chr9:13620499..13620576 -)
Downstram Exon
ENSMUSE00000214675 (Chr9:13617854..13617964 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGTCCAAACTCCGTGAAG Chr9:13620540..13620559 59.7 55 AGTGCTGGTTGAAACACATGA Chr9:13617871..13617891 59.2 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000311912 Chr9:13631300..13631433 GCGGCTTCTGATTCTCAGTT Chr9:13631304..13631323 59.58 50
upstream ENSMUSE00000539746 Chr9:13625971..13626127 AGCGTCCTAGCTGAACCATC Chr9:13626108..13626127 59.46 55
upstream ENSMUSE00000311872 Chr9:13623303..13623482 GGAAAGGATTCAGGCAGAAG Chr9:13623411..13623430 58.86 50
upstream ENSMUSE00000539745 Chr9:13622767..13622888 TGCAGAAATGGAGAGGACATC Chr9:13622783..13622803 60.21 47.62
upstream ENSMUSE00000214672 Chr9:13621331..13621447 TCAGAGCCAGCTGGAAAAAC Chr9:13621387..13621406 60.52 50
upstream ENSMUSE00000214669 Chr9:13620499..13620576 GGAGTCCAAACTCCGTGAAG Chr9:13620540..13620559 59.7 55

*** Putative Vector Insertion (Chr 9: 13617965 - 13620498) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214675 Chr9:13617854..13617964 AGTGCTGGTTGAAACACATGA Chr9:13617871..13617891 59.2 42.86
downstream ENSMUSE00000214670 Chr9:13617077..13617154 GTAATGTGGCTGTGCACCAA Chr9:13617094..13617113 60.58 50
downstream ENSMUSE00000214679 Chr9:13615071..13615306 CATTTGCCCAAATTCATCCT Chr9:13615054..13615073 59.76 40
downstream ENSMUSE00000214677 Chr9:13614304..13614448 ATGCCTCCAATTCACACTCC Chr9:13614344..13614363 59.93 50
downstream ENSMUSE00000539736 Chr9:13612227..13613284 TCTCTGTTTGGCCAGATCCT Chr9:13613125..13613144 59.8 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACAAGTAATCGCCTTGCAG Chr9:13620433..13620453 59.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTGAAGAAGAGCAGGAAA Chr9:13620526..13620546 60.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031922