Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4182
Trapped Gene
Mcm3 (ENSMUSG00000041859)
Vector Insertion
Chr 1: 20794989 - 20795343
Public Clones AM0569 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000308137 (Chr1:20795344..20795420 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGACTCATGCCAAGGATGG Chr1:20795397..20795416 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000308137 (Chr1:20795344..20795420 -)
Downstram Exon
ENSMUSE00000308126 (Chr1:20794898..20794988 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGACTCATGCCAAGGATGG Chr1:20795397..20795416 60.07 50 TCCACTTTCTGGGAGTCCTG Chr1:20794891..20794910 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355532 Chr1:20810212..20810306 GGCACAGTAGTGCTGGATGA Chr1:20810264..20810283 59.86 55
upstream ENSMUSE00000308240 Chr1:20807874..20807986 GAACAAGGTTCGGGAACTGA Chr1:20807947..20807966 60.09 50
upstream ENSMUSE00000308232 Chr1:20807324..20807532 CCACCTACGCCAAGCAGTAT Chr1:20807439..20807458 60.15 55
upstream ENSMUSE00000308225 Chr1:20806730..20806860 TCACCACCCTAGTGGCTTTC Chr1:20806757..20806776 60.11 55
upstream ENSMUSE00000308216 Chr1:20804770..20805008 AGGACCATCAGACCATCACC Chr1:20804940..20804959 59.77 55
upstream ENSMUSE00000308208 Chr1:20804480..20804588 ACCGTCCTGATTGCCTGTAA Chr1:20804568..20804587 60.52 50
upstream ENSMUSE00000308199 Chr1:20803042..20803195 CACATCCGTGGAGACATCAA Chr1:20803056..20803075 60.53 50
upstream ENSMUSE00000604364 Chr1:20802645..20802776 CTCCTCTGGAGTGGGTCTCA Chr1:20802675..20802694 60.39 60
upstream ENSMUSE00000604363 Chr1:20802046..20802254 GCTGCCAATCCAGTCTATGG Chr1:20802050..20802069 60.62 55
upstream ENSMUSE00000552279 Chr1:20800139..20800313 GATCGGGAGATCTCAGACCA Chr1:20800189..20800208 60.16 55
upstream ENSMUSE00000308175 Chr1:20799677..20799803 GCCATTGGGTAGTTCAGTGG Chr1:20799780..20799799 60.38 55
upstream ENSMUSE00000604362 Chr1:20798802..20798952 TCACGTGGCCAAAATTATCA Chr1:20798894..20798913 59.93 40
upstream ENSMUSE00000308157 Chr1:20796823..20796963 CTCCAGTTACAGCACGGACA Chr1:20796940..20796959 59.9 55
upstream ENSMUSE00000308147 Chr1:20795878..20795981 GAGCCAGGAAGACACTGAGC Chr1:20795891..20795910 60.14 60
upstream ENSMUSE00000308137 Chr1:20795344..20795420 AAGACTCATGCCAAGGATGG Chr1:20795397..20795416 60.07 50

*** Putative Vector Insertion (Chr 1: 20794989 - 20795343) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000308126 Chr1:20794898..20794988 TCCACTTTCTGGGAGTCCTG Chr1:20794891..20794910 60.23 55
downstream ENSMUSE00000396520 Chr1:20793096..20793735 TAACAAACGCAGGACACAGC Chr1:20793257..20793276 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTGCAGTTGCTGTTTGTG Chr1:20795299..20795319 60.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTTGTGTGCCTTTCGTG Chr1:20795288..20795308 60.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041859