Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI42
Trapped Gene
Hnrpab (ENSMUSG00000020358)
Vector Insertion
Chr 11: 51415393 - 51416094
Public Clones GC0296 (tigem) DA0042 (sanger) CSI512 (baygenomics) Ex166 (baygenomics)
YTC446 (baygenomics) BGB002 (baygenomics) CSI824 (baygenomics) RRS341 (baygenomics)
PST5069-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000400204 (Chr11:51416095..51416197 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000400204 (Chr11:51416095..51416197 -)
Downstram Exon
ENSMUSE00000653762 (Chr11:51415252..51415392 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000294713 Chr11:51420169..51420349 No primer for this exon
upstream ENSMUSE00000579971 Chr11:51419842..51420088 No primer for this exon
upstream ENSMUSE00000722048 Chr11:51419842..51420088 No primer for this exon
upstream ENSMUSE00000103710 Chr11:51418963..51419131 No primer for this exon
upstream ENSMUSE00000103709 Chr11:51418161..51418319 No primer for this exon
upstream ENSMUSE00000103708 Chr11:51417902..51418033 No primer for this exon
upstream ENSMUSE00000400204 Chr11:51416095..51416197 No primer for this exon

*** Putative Vector Insertion (Chr 11: 51415393 - 51416094) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000653762 Chr11:51415252..51415392 No primer for this exon
downstream ENSMUSE00000653761 Chr11:51414371..51415392 No primer for this exon
downstream ENSMUSE00000465513 Chr11:51413602..51414980 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGAGGTAAGTGGGAGCTG Chr11:51416079..51416099 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGAGGTAAGTGGGAGCTG Chr11:51416079..51416099 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAGCCCAAAGAGGTGTATC Chr11:51416159..51416179 59.55 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCAGTCGTGACTGGGAAAAC Chr11:51416132..51416152 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020358