Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4223
Trapped Gene
1500012F01Rik (ENSMUSG00000074578)
Vector Insertion
Chr 2: 166890718 - 166890933
Public Clones AL0388 (sanger)
Private Clones OST208103 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639034 (Chr2:166890659..166890717 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTTGAATGGAGCGTGAAC Chr2:166890681..166890700 60.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639034 (Chr2:166890659..166890717 +)
Downstram Exon
ENSMUSE00000639033 (Chr2:166890934..166890980 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTTGAATGGAGCGTGAAC Chr2:166890681..166890700 60.79 50 AGATCAGACCAACACCTGCAT Chr2:166890973..166890993 59.59 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639036 Chr2:166888722..166888797 GGCTCCTAGAGCGTTTGCTT Chr2:166888735..166888754 61.03 55
upstream ENSMUSE00000639035 Chr2:166889136..166889227 GCATCGAGGGAGATGAGAAC Chr2:166889183..166889202 59.77 55
upstream ENSMUSE00000639034 Chr2:166890659..166890717 GCTTTGAATGGAGCGTGAAC Chr2:166890681..166890700 60.79 50

*** Putative Vector Insertion (Chr 2: 166890718 - 166890933) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639033 Chr2:166890934..166890980 AGATCAGACCAACACCTGCAT Chr2:166890973..166890993 59.59 47.62
downstream ENSMUSE00000639032 Chr2:166891187..166891355 CACTACTCCCCAGCCAAAAA Chr2:166891289..166891308 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGTGTCCCTCTTCCAGTGT Chr2:166890732..166890752 59.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACGTGACTGGGAAAACC Chr2:166890765..166890785 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074578