Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4248
Trapped Gene
Cs (ENSMUSG00000005683)
Vector Insertion
Chr 10: 127775016 - 127786808
Public Clones AN0926 (sanger) (sanger) AJ0634 (sanger) (sanger) RRC290 (baygenomics)
RRJ140 (baygenomics) RRK198 (baygenomics) (ggtc) P124B11 (ggtc)
(ggtc) P124B11 (ggtc) PST5711-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000368151 (Chr10:127774790..127775015 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000368151 (Chr10:127774790..127775015 +)
Downstram Exon
ENSMUSE00000150364 (Chr10:127786809..127786859 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000368151 Chr10:127774790..127775015 No primer for this exon

*** Putative Vector Insertion (Chr 10: 127775016 - 127786808) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000150364 Chr10:127786809..127786859 No primer for this exon
downstream ENSMUSE00000150363 Chr10:127787489..127787596 No primer for this exon
downstream ENSMUSE00000150366 Chr10:127788255..127788320 No primer for this exon
downstream ENSMUSE00000150369 Chr10:127789730..127789861 No primer for this exon
downstream ENSMUSE00000150371 Chr10:127790079..127790267 No primer for this exon
downstream ENSMUSE00000150357 Chr10:127795390..127795589 No primer for this exon
downstream ENSMUSE00000150362 Chr10:127796226..127796355 No primer for this exon
downstream ENSMUSE00000270596 Chr10:127796490..127796591 No primer for this exon
downstream ENSMUSE00000150368 Chr10:127797000..127797209 No primer for this exon
downstream ENSMUSE00000350412 Chr10:127798024..127799534 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGCCAAGGTGAGCTTAAA Chr10:127781008..127781028 59.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATAAACGTGACTGGGAAAACC Chr10:127781061..127781083 58.05 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005683