Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4256
Trapped Gene
Bxdc5 (ENSMUSG00000028187)
Vector Insertion
Chr 3: 146175876 - 146180689
Public Clones AJ0459 (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000177102 (Chr3:146180690..146180770 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTTTACGACGAGACCACAG Chr3:146180710..146180729 59.36 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000177102 (Chr3:146180690..146180770 -)
Downstram Exon
ENSMUSE00000177106 (Chr3:146175780..146175875 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTTTACGACGAGACCACAG Chr3:146180710..146180729 59.36 55 AATTCATCCGTCGCTTCATC Chr3:146175825..146175844 60.04 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000177104 Chr3:146184133..146184372 CGTAAACAACATGGCGAAGG Chr3:146184351..146184370 61.43 50
upstream ENSMUSE00000177098 Chr3:146182351..146182407 GAGAGAGGCTCTTGGCGATA Chr3:146182353..146182372 59.68 55
upstream ENSMUSE00000177102 Chr3:146180690..146180770 CGTTTACGACGAGACCACAG Chr3:146180710..146180729 59.36 55

*** Putative Vector Insertion (Chr 3: 146175876 - 146180689) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000177106 Chr3:146175780..146175875 AATTCATCCGTCGCTTCATC Chr3:146175825..146175844 60.04 45
downstream ENSMUSE00000177105 Chr3:146175106..146175259 TTTCAGAGCCAGTCCTCGTC Chr3:146175157..146175176 60.53 55
downstream ENSMUSE00000177101 Chr3:146171106..146171188 ACGAAGACGAACACTGCTCA Chr3:146171096..146171115 59.62 50
downstream ENSMUSE00000177100 Chr3:146170478..146170659 GCGTCCAATAGAATGGCCTA Chr3:146170554..146170573 60.06 50
downstream ENSMUSE00000177099 Chr3:146170036..146170162 TAAAACGTGGTCCGAGTTCC Chr3:146170085..146170104 59.97 50
downstream ENSMUSE00000342380 Chr3:146169312..146169539 TTTTCAAGACAGGCCAATCC Chr3:146169426..146169445 60.05 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATCACCCTTGGTGTGTTG Chr3:146177644..146177664 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATCACCCTTGGTGTGTTG Chr3:146177644..146177664 60.42 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCCTGTTCCCAAGACCATT Chr3:146180739..146180759 60.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCCTGTTCCCAAGACCATT Chr3:146180739..146180759 60.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028187