Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4260
Trapped Gene
Fh1 (ENSMUSG00000026526)
Vector Insertion
Chr 1: 177542461 - 177544867
Public Clones AJ0285 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000160214 (Chr1:177544868..177545044 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTGGCAGACTGGATCAGG Chr1:177544986..177545005 60.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000160214 (Chr1:177544868..177545044 -)
Downstram Exon
ENSMUSE00000160216 (Chr1:177542278..177542460 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTGGCAGACTGGATCAGG Chr1:177544986..177545005 60.66 55 GTGTGAGTTCGCCCAATTTT Chr1:177542287..177542306 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362299 Chr1:177555582..177555719 TACAGCAGCACCATGTACCG Chr1:177555697..177555716 60.74 55
upstream ENSMUSE00000160218 Chr1:177549182..177549316 GCCAAAATTCCTTCCGTGTA Chr1:177549293..177549312 59.94 45
upstream ENSMUSE00000160219 Chr1:177546660..177546770 CATTCAAGCTTTCGGCATCT Chr1:177546743..177546762 60.35 45
upstream ENSMUSE00000160214 Chr1:177544868..177545044 GTTTGGCAGACTGGATCAGG Chr1:177544986..177545005 60.66 55

*** Putative Vector Insertion (Chr 1: 177542461 - 177544867) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000160216 Chr1:177542278..177542460 GTGTGAGTTCGCCCAATTTT Chr1:177542287..177542306 59.98 45
downstream ENSMUSE00000160217 Chr1:177539768..177539933 CGCATACTGGACTTGCTGAA Chr1:177539876..177539895 60.01 50
downstream ENSMUSE00000160223 Chr1:177537948..177538151 CAGAACCCAGGAAGCGAATA Chr1:177537992..177538011 60.21 50
downstream ENSMUSE00000160224 Chr1:177536186..177536313 CCTCCAACGGTAACAGCAAC Chr1:177536207..177536226 60.55 55
downstream ENSMUSE00000160221 Chr1:177534069..177534222 AGCTTGTTGATCCGCTCTGT Chr1:177534094..177534113 60.02 50
downstream ENSMUSE00000371921 Chr1:177531515..177531697 CTTGGGTTTCACCCACTCAT Chr1:177531554..177531573 59.82 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:177544797..177544817 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACCCCAATGATCATGTTA Chr1:177544877..177544897 59.21 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026526