Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4261
Trapped Gene
Hn1 (ENSMUSG00000020737)
Vector Insertion
Chr 11: 115364489 - 115375533
Public Clones AJ0212 (sanger) (sanger) AH0129 (sanger) RRE006 (baygenomics) P012C04 (ggtc)
(ggtc) D003D02 (ggtc) W247B02 (ggtc) P027A01 (ggtc) (egtc)
IST14312C4 (tigm) IST14288G2 (tigm) IST11322B8 (tigm) IST14887C6 (tigm)
IST14881D7 (tigm)
Private Clones OST462555 (lexicon) OST457274 (lexicon) OST413997 (lexicon) OST403884 (lexicon)
OST380603 (lexicon) OST351392 (lexicon) OST342805 (lexicon) OST320051 (lexicon)
OST301336 (lexicon) OST297662 (lexicon) OST239836 (lexicon) OST238888 (lexicon)
OST209763 (lexicon) OST183480 (lexicon) OST137123 (lexicon) OST132663 (lexicon)
OST115173 (lexicon) OST91076 (lexicon) OST52467 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000257397 (Chr11:115375534..115375698 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000257397 (Chr11:115375534..115375698 -)
Downstram Exon
ENSMUSE00000257388 (Chr11:115364346..115364488 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000257397 Chr11:115375534..115375698 No primer for this exon

*** Putative Vector Insertion (Chr 11: 115364489 - 115375533) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000257388 Chr11:115364346..115364488 No primer for this exon
downstream ENSMUSE00000108845 Chr11:115363319..115363416 No primer for this exon
downstream ENSMUSE00000646221 Chr11:115361980..115361998 No primer for this exon
downstream ENSMUSE00000257359 Chr11:115358669..115359613 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCTAACAGCAGGAACAGC Chr11:115369537..115369557 59.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACCCTAACAGCAGGAACA Chr11:115375539..115375559 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCCTGGTGGTTTAGCTTTTG Chr11:115369660..115369680 59.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGAGGAGTTCTGTGCACTT Chr11:115369722..115369742 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020737