Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4265
Trapped Gene
AC165281.2 (ENSMUSG00000042590)
Vector Insertion
Chr 13: 107585876 - 107602287
Public Clones AJ0163 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311942 (Chr13:107602288..107602372 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACACGAGGAACCGAAAGT Chr13:107602337..107602356 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311942 (Chr13:107602288..107602372 -)
Downstram Exon
ENSMUSE00000679784 (Chr13:107585711..107585875 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACACGAGGAACCGAAAGT Chr13:107602337..107602356 60.15 50 TTTCCATGAGGGACTGGAAG Chr13:107585742..107585761 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000508911 Chr13:107726840..107726995 GCGTTCCTAGAAGCCGTTTT Chr13:107726959..107726978 60.74 50
upstream ENSMUSE00000610475 Chr13:107715093..107715236 CTAACACAGGCCACCAGTCA Chr13:107715172..107715191 59.74 55
upstream ENSMUSE00000610474 Chr13:107709604..107709704 ATCGTTACTGGAGGCGTGTC Chr13:107709612..107709631 60.14 55
upstream ENSMUSE00000610473 Chr13:107700824..107700896 CAGGGCTCATCACCAACTTT Chr13:107700842..107700861 60.11 50
upstream ENSMUSE00000610472 Chr13:107700280..107700483 CCAAGGTTGCTCGGTTAGAC Chr13:107700436..107700455 59.73 55
upstream ENSMUSE00000610471 Chr13:107690765..107690897 AGCACGTTTCTTCTGGCAAT Chr13:107690814..107690833 59.88 45
upstream ENSMUSE00000610470 Chr13:107688999..107689057 GCTGCGGAAGTTAACTGTGA Chr13:107689037..107689056 59.08 50
upstream ENSMUSE00000610469 Chr13:107687296..107687344 No primer for this exon
upstream ENSMUSE00000610468 Chr13:107685885..107685955 No primer for this exon
upstream ENSMUSE00000610467 Chr13:107682503..107682695 TTTGAGCGATTCATTGTCCA Chr13:107682568..107682587 60.2 40
upstream ENSMUSE00000610466 Chr13:107681696..107681848 CATGTGGGAGGAAGATCCAG Chr13:107681705..107681724 60.47 55
upstream ENSMUSE00000610465 Chr13:107679443..107679486 No primer for this exon
upstream ENSMUSE00000610464 Chr13:107676747..107676837 No primer for this exon
upstream ENSMUSE00000610463 Chr13:107673606..107673653 No primer for this exon
upstream ENSMUSE00000334627 Chr13:107672922..107673027 GGGATTAGCTGCTTTTGAGC Chr13:107672995..107673014 59.07 50
upstream ENSMUSE00000393320 Chr13:107669693..107669819 ATTACGACGCAGGGTGATTT Chr13:107669791..107669810 59.46 45
upstream ENSMUSE00000568985 Chr13:107667015..107667048 TCCGAATTGAAACAGCAACA Chr13:107667028..107667047 60.23 40
upstream ENSMUSE00000639865 Chr13:107666319..107666359 No primer for this exon
upstream ENSMUSE00000610461 Chr13:107665571..107665687 TCGAAAGAGTCAACGTGCAG Chr13:107665571..107665590 60.17 50
upstream ENSMUSE00000610460 Chr13:107660755..107660868 GGAAGCAGAGCGAAGAACAC Chr13:107660803..107660822 60.14 55
upstream ENSMUSE00000610459 Chr13:107655945..107656060 TCCTGCTCCCAGTTATCCAG Chr13:107656007..107656026 60.21 55
upstream ENSMUSE00000311873 Chr13:107650941..107651017 CATTGGAGAACAGCCCATGT Chr13:107650990..107651009 60.92 50
upstream ENSMUSE00000679785 Chr13:107647579..107647605 No primer for this exon
upstream ENSMUSE00000311865 Chr13:107647309..107647388 No primer for this exon
upstream ENSMUSE00000339319 Chr13:107646818..107646898 CAGGTTTGTGCCAGTCCTTT Chr13:107646869..107646888 60.15 50
upstream ENSMUSE00000382317 Chr13:107638321..107638416 TTAGGCCCACAGATGTTTCA Chr13:107638364..107638383 59.12 45
upstream ENSMUSE00000405267 Chr13:107637426..107637539 GCTGTCATGGGTCGAGTCTT Chr13:107637490..107637509 60.27 55
upstream ENSMUSE00000504867 Chr13:107632169..107632290 ACACAGCCCGAAAGAAAGAA Chr13:107632214..107632233 59.85 45
upstream ENSMUSE00000610458 Chr13:107626292..107626476 AGCCTTAAAGCCACGTGATG Chr13:107626312..107626331 60.27 50
upstream ENSMUSE00000311949 Chr13:107613036..107613131 TGGAGGCTCTTCATGATGTC Chr13:107613071..107613090 58.75 50
upstream ENSMUSE00000311942 Chr13:107602288..107602372 CAACACGAGGAACCGAAAGT Chr13:107602337..107602356 60.15 50

*** Putative Vector Insertion (Chr 13: 107585876 - 107602287) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679784 Chr13:107585711..107585875 TTTCCATGAGGGACTGGAAG Chr13:107585742..107585761 60.04 50
downstream ENSMUSE00000311936 Chr13:107584520..107585875 GGTTCCTCACAATGGCAAGT Chr13:107584694..107584713 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGCCACCCACAGAACAAG Chr13:107590303..107590323 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCCACCCACAGAACAAG Chr13:107590303..107590323 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042590