Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4277
Trapped Gene
Slc30a6 (ENSMUSG00000024069)
Vector Insertion
Chr 17: 74818941 - 74822356
Public Clones AM0292 (sanger) AM0285 (sanger) AH0442 (sanger) AM0291 (sanger)
RRM224 (baygenomics) XB487 (baygenomics) CMHD-GT_422A10-3 (cmhd) CMHD-GT_535H12-3 (cmhd)
CMHD-GT_405G2-3 (cmhd) IST14956G3 (tigm)
Private Clones OST184590 (lexicon) OST25363 (lexicon) OST16879 (lexicon) OST5625 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137946 (Chr17:74818872..74818940 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACCTTGGATGGGGTGCTA Chr17:74818876..74818895 59.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137946 (Chr17:74818872..74818940 +)
Downstram Exon
ENSMUSE00000656979 (Chr17:74822357..74823569 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACCTTGGATGGGGTGCTA Chr17:74818876..74818895 59.95 55 AAGGACCATTTGTTCGTTCG Chr17:74822413..74822432 59.97 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692249 Chr17:74794972..74795008 GCTGTACGGCTCCTTACCAT Chr17:74794988..74795007 59.22 55
upstream ENSMUSE00000383604 Chr17:74801252..74801338 TAGACTTGTCGCAGCTGACC Chr17:74801314..74801333 59.19 55
upstream ENSMUSE00000394914 Chr17:74803344..74803428 CTTCTGTTCGGTGCAATCAA Chr17:74803356..74803375 59.84 45
upstream ENSMUSE00000369221 Chr17:74805025..74805067 No primer for this exon
upstream ENSMUSE00000413190 Chr17:74806561..74806626 TGAGGAAACCTAGCCCTGTCT Chr17:74806596..74806616 60.25 52.38
upstream ENSMUSE00000367165 Chr17:74808186..74808266 ACAATTGGGAGCCCTCTTTA Chr17:74808234..74808253 58.65 45
upstream ENSMUSE00000338492 Chr17:74808693..74808728 No primer for this exon
upstream ENSMUSE00000375948 Chr17:74809674..74809768 TTTCAACCTGTTCACGATGC Chr17:74809710..74809729 59.7 45
upstream ENSMUSE00000335967 Chr17:74811614..74811662 AGTACGAGCTGGCTTCAGGA Chr17:74811619..74811638 60.16 55
upstream ENSMUSE00000137945 Chr17:74811947..74812066 GCATGAATCCGTTTGTTCTG Chr17:74811991..74812010 59.13 45
upstream ENSMUSE00000137950 Chr17:74814960..74815062 ATGACGTTTGGCACCATGTA Chr17:74815006..74815025 59.85 45
upstream ENSMUSE00000137948 Chr17:74817960..74818007 CCACCTCATGTTATCGGTCA Chr17:74817966..74817985 59.37 50
upstream ENSMUSE00000137946 Chr17:74818872..74818940 CTACCTTGGATGGGGTGCTA Chr17:74818876..74818895 59.95 55

*** Putative Vector Insertion (Chr 17: 74818941 - 74822356) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000656979 Chr17:74822357..74823569 AAGGACCATTTGTTCGTTCG Chr17:74822413..74822432 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr17:74821989..74822009 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCTGGTATCTCAGGTGTG Chr17:74821916..74821936 60.53 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024069