Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4278
Trapped Gene
Depdc2 (ENSMUSG00000048960)
Vector Insertion
Chr 1: 11058197 - 11070103
Public Clones AH0440 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000604637 (Chr1:11058092..11058196 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACCATGAAAAGGCACAAA Chr1:11058127..11058146 59.56 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000604637 (Chr1:11058092..11058196 +)
Downstram Exon
ENSMUSE00000604636 (Chr1:11070104..11070205 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACCATGAAAAGGCACAAA Chr1:11058127..11058146 59.56 40 CTTCCAGGGGAACGTCTGTA Chr1:11070155..11070174 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000604640 Chr1:10983546..10983990 GACTGTCCCGTTCTGAGTCC Chr1:10983651..10983670 59.69 60
upstream ENSMUSE00000604639 Chr1:11051407..11051478 GCATCGAATGAACCAATGTG Chr1:11051415..11051434 59.93 45
upstream ENSMUSE00000604638 Chr1:11055875..11055997 CGAGGAGATCCTCATCGTTC Chr1:11055892..11055911 59.76 55
upstream ENSMUSE00000604637 Chr1:11058092..11058196 CAACCATGAAAAGGCACAAA Chr1:11058127..11058146 59.56 40

*** Putative Vector Insertion (Chr 1: 11058197 - 11070103) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000604636 Chr1:11070104..11070205 CTTCCAGGGGAACGTCTGTA Chr1:11070155..11070174 60.1 55
downstream ENSMUSE00000604635 Chr1:11079798..11079959 TTGGAGTGCTTCCATCACTG Chr1:11079863..11079882 59.83 50
downstream ENSMUSE00000372674 Chr1:11088544..11088677 GGACTCCACACATCAGCATC Chr1:11088595..11088614 59.05 55
downstream ENSMUSE00000317687 Chr1:11091145..11091248 CCCATCTGTGGATGCCTTAC Chr1:11091181..11091200 60.34 55
downstream ENSMUSE00000154242 Chr1:11097684..11097833 CTTCCACCCATTCACAACAA Chr1:11097730..11097749 59.39 45
downstream ENSMUSE00000154247 Chr1:11100363..11100507 CCCAGGTGTCTTGTTCCATT Chr1:11100398..11100417 59.82 50
downstream ENSMUSE00000154246 Chr1:11102824..11102924 CAGCGCTTGTCCTAAGTGAA Chr1:11102902..11102921 59.22 50
downstream ENSMUSE00000154240 Chr1:11113202..11113305 AAATCACGTCCTGCATCTCA Chr1:11113303..11113322 59.24 45
downstream ENSMUSE00000317645 Chr1:11113895..11113944 CTGACCACTGGGGTAAACAGA Chr1:11113946..11113966 60.01 52.38
downstream ENSMUSE00000317639 Chr1:11122419..11122494 TTGGCCATGACAACAGATTT Chr1:11122469..11122488 58.98 40
downstream ENSMUSE00000154253 Chr1:11126846..11126918 CATTGTCACAGAGCCCAACA Chr1:11126906..11126925 60.72 50
downstream ENSMUSE00000317624 Chr1:11130037..11130179 AGCGGAAAAGTAGAGGCTCA Chr1:11130084..11130103 59.22 50
downstream ENSMUSE00000317616 Chr1:11130317..11130409 AGCTGCCTTCGTTGGATTTA Chr1:11130341..11130360 59.85 45
downstream ENSMUSE00000478314 Chr1:11132730..11132878 GCACGATTTCAGGAAGCAAT Chr1:11132831..11132850 60.22 45
downstream ENSMUSE00000431599 Chr1:11139891..11139976 GTCCAAAGCCTCTGATCTGG Chr1:11139952..11139971 59.8 55
downstream ENSMUSE00000431593 Chr1:11143624..11143760 CATTGGCCGTTTGTATTTCC Chr1:11143760..11143779 60.19 45
downstream ENSMUSE00000431578 Chr1:11146322..11146439 TGCACTCAAAAGCATCTCCA Chr1:11146433..11146452 60.54 45
downstream ENSMUSE00000604634 Chr1:11150177..11150361 CCATACTCGAGGTGGACGTT Chr1:11150270..11150289 59.99 55
downstream ENSMUSE00000604633 Chr1:11152321..11152482 GATCAGTGGCGATCACTTCA Chr1:11152411..11152430 59.79 50
downstream ENSMUSE00000604632 Chr1:11159934..11160156 ATCTAGCTGCACACCGAAGG Chr1:11160110..11160129 60.42 55
downstream ENSMUSE00000604631 Chr1:11160665..11160872 TACACCATGGGGCTCAGTTT Chr1:11160689..11160708 60.38 50
downstream ENSMUSE00000470229 Chr1:11171936..11172115 TCTTGCTCATCCCCTGCTAC Chr1:11172076..11172095 60.36 55
downstream ENSMUSE00000471115 Chr1:11174527..11174621 ACTCGTGAAGGAAGCAATGG Chr1:11174572..11174591 60.26 50
downstream ENSMUSE00000341656 Chr1:11175211..11175293 TCCGGACACTGATAGGAAGC Chr1:11175240..11175259 60.22 55
downstream ENSMUSE00000317530 Chr1:11175968..11176058 CGACCCGGTGTGAGATACTT Chr1:11176050..11176069 59.99 55
downstream ENSMUSE00000317524 Chr1:11176718..11176846 CAACTCAGCTTTGCCTCCAT Chr1:11176754..11176773 60.4 50
downstream ENSMUSE00000604630 Chr1:11183594..11183635 AGCCAGTAGTATGCGGCACT Chr1:11183622..11183641 59.93 55
downstream ENSMUSE00000317519 Chr1:11189916..11190133 CAGTGGCCACAAGACTTTGA Chr1:11189975..11189994 59.87 50
downstream ENSMUSE00000317510 Chr1:11194147..11194249 CAGGGCAACCAGTGTATCCT Chr1:11194191..11194210 59.99 55
downstream ENSMUSE00000317501 Chr1:11198593..11198736 GCAGCTGCTCAAAATGGTAA Chr1:11198682..11198701 59.07 45
downstream ENSMUSE00000317492 Chr1:11221763..11221877 TTCCAGGGAGGCTGTGTTTA Chr1:11221851..11221870 60.63 50
downstream ENSMUSE00000317484 Chr1:11255760..11255826 GTATTCGGTGGGGAATTTGA Chr1:11255801..11255820 59.62 45
downstream ENSMUSE00000317475 Chr1:11256050..11256240 GAGGTGATCAGCCGGTAAAG Chr1:11256102..11256121 59.69 55
downstream ENSMUSE00000317471 Chr1:11275138..11275240 ATCCATGGCCTGCATAATGT Chr1:11275228..11275247 60.19 45
downstream ENSMUSE00000317464 Chr1:11279334..11279401 AACGCCCAAGTTTTTAGCTG Chr1:11279375..11279394 59.4 45
downstream ENSMUSE00000604629 Chr1:11287789..11288582 CTGTCCATTGGGGAAGCTAA Chr1:11288163..11288182 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr1:11058245..11058265 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACCGTGACTGGGAAAAC Chr1:11058243..11058263 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048960