Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI428
Trapped Gene
Plekhf2 (ENSMUSG00000049969)
Vector Insertion
Chr 4: 10918502 - 10934539
Public Clones (sanger) DD0686 (sanger) (sanger) (sanger) E088D01 (ggtc) P148E03 (ggtc)
D095E03 (ggtc) 3SE287H12 (ggtc) M007C04 (ggtc) E120C02 (ggtc) E087A08 (ggtc)
P143H10 (ggtc) D079C10 (ggtc) E091A08 (ggtc) D119H09 (ggtc) 5SE287H12 (ggtc)
(ggtc) P089F11 (ggtc) P120A06 (ggtc) D021C10 (ggtc) CMHD-GT_311A03-3 (cmhd)
CMHD-GT_181A2-3 (cmhd) CMHD-GT_118E2-3 (cmhd) CMHD-GT_401F9-3 (cmhd) CMHD-GT_494G9-3 (cmhd)
CMHD-GT_175A4-3 (cmhd) CMHD-GT_155C3-3 (cmhd) CMHD-GT_542B3-3S (cmhd) CMHD-GT_318H09-3 (cmhd)
CMHD-GT_307D10-3 (cmhd) CMHD-GT_171D7-3 (cmhd) CMHD-GT_132F5-3 (cmhd) CMHD-GT_542B3-3 (cmhd)
PST12600-NL (escells) PST23652-NR (escells) PST10527-NR (escells) PST23639-NR (escells)
PST12600-NR (escells) PST26026-NR (escells) PST6994-NR (escells) IST10047B2 (tigm)
IST10923D10 (tigm)
Private Clones OST430247 (lexicon) OST423731 (lexicon) OST277438 (lexicon) OST260803 (lexicon)
OST230867 (lexicon) OST224348 (lexicon) OST195214 (lexicon) OST194168 (lexicon)
OST191582 (lexicon) OST183424 (lexicon) OST183035 (lexicon) OST157746 (lexicon)
OST148521 (lexicon) OST131646 (lexicon) OST86288 (lexicon) OST67935 (lexicon)
OST62931 (lexicon) OST43589 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000355951 (Chr4:10934540..10934717 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000355951 (Chr4:10934540..10934717 -)
Downstram Exon
ENSMUSE00000407042 (Chr4:10915810..10918501 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCAGCATAAACTGCAAACGA Chr4:10918125..10918144 60.02 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355951 Chr4:10934540..10934717 No primer for this exon

*** Putative Vector Insertion (Chr 4: 10918502 - 10934539) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000407042 Chr4:10915810..10918501 GCAGCATAAACTGCAAACGA Chr4:10918125..10918144 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCAGAGATGGCAGTCAGTT Chr4:10928516..10928537 58.45 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCAGAGATGGCAGTCAGTT Chr4:10928516..10928537 58.45 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAGCAATCCTCAGGCCAGT Chr4:10925686..10925706 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CACTCCGTGACTGGGAAAAC Chr4:10934652..10934672 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049969