Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4291
Trapped Gene
Rabep1 (ENSMUSG00000020817)
Vector Insertion
Chr 11: 70736744 - 70739273
Public Clones AH0003 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000109555 (Chr11:70736645..70736743 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000109555 (Chr11:70736645..70736743 +)
Downstram Exon
ENSMUSE00000109546 (Chr11:70739274..70739414 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000578609 Chr11:70658265..70658510 No primer for this exon
upstream ENSMUSE00000651279 Chr11:70688248..70688376 No primer for this exon
upstream ENSMUSE00000651277 Chr11:70698267..70698470 No primer for this exon
upstream ENSMUSE00000109552 Chr11:70700513..70700673 No primer for this exon
upstream ENSMUSE00000318390 Chr11:70707071..70707190 No primer for this exon
upstream ENSMUSE00000677100 Chr11:70707071..70707193 No primer for this exon
upstream ENSMUSE00000318425 Chr11:70713974..70714109 No primer for this exon
upstream ENSMUSE00000318419 Chr11:70718107..70718285 No primer for this exon
upstream ENSMUSE00000109545 Chr11:70721888..70722019 No primer for this exon
upstream ENSMUSE00000109548 Chr11:70730817..70731284 No primer for this exon
upstream ENSMUSE00000109562 Chr11:70732679..70732783 No primer for this exon
upstream ENSMUSE00000109560 Chr11:70734354..70734470 No primer for this exon
upstream ENSMUSE00000109555 Chr11:70736645..70736743 No primer for this exon

*** Putative Vector Insertion (Chr 11: 70736744 - 70739273) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109546 Chr11:70739274..70739414 No primer for this exon
downstream ENSMUSE00000109549 Chr11:70747907..70748096 No primer for this exon
downstream ENSMUSE00000677101 Chr11:70748623..70748684 No primer for this exon
downstream ENSMUSE00000109565 Chr11:70748629..70748684 No primer for this exon
downstream ENSMUSE00000109543 Chr11:70751026..70751124 No primer for this exon
downstream ENSMUSE00000482599 Chr11:70753382..70753498 No primer for this exon
downstream ENSMUSE00000677099 Chr11:70753382..70753600 No primer for this exon
downstream ENSMUSE00000454700 Chr11:70753884..70754805 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGAGCTTTTCCCAAGCAA Chr11:70736702..70736722 59.99 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGAGCTTTTCCCAAGCAA Chr11:70736702..70736722 59.99 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020817