Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI43
Trapped Gene
Rnf111 (ENSMUSG00000032217)
Vector Insertion
Chr 9: 70305826 - 70306796
Public Clones GC0313 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217800 (Chr9:70306797..70306960 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAAACCGCAGTAGGATCTC Chr9:70306862..70306881 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217800 (Chr9:70306797..70306960 -)
Downstram Exon
ENSMUSE00000217793 (Chr9:70305631..70305825 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAAACCGCAGTAGGATCTC Chr9:70306862..70306881 59.84 55 TCAGAGGCTTGCTCAGAGGT Chr9:70305704..70305723 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512819 Chr9:70351266..70351532 GTGTTGACAGACGCCCTCCT Chr9:70351370..70351389 62.65 60
upstream ENSMUSE00000696308 Chr9:70351039..70351161 ATTGTGTCCGGGCAAGAGTC Chr9:70351074..70351093 62.41 55
upstream ENSMUSE00000318624 Chr9:70350747..70350809 ATTGATCGGAGTCAGCAGTG Chr9:70350787..70350806 58.83 50
upstream ENSMUSE00000318604 Chr9:70323583..70324475 TTCATGGCAGTGCACTAAGG Chr9:70323836..70323855 59.86 50
upstream ENSMUSE00000217799 Chr9:70317162..70317288 CTTCACTCCCCAGGTCACTG Chr9:70317232..70317251 60.7 60
upstream ENSMUSE00000217800 Chr9:70306797..70306960 CGAAACCGCAGTAGGATCTC Chr9:70306862..70306881 59.84 55

*** Putative Vector Insertion (Chr 9: 70305826 - 70306796) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217793 Chr9:70305631..70305825 TCAGAGGCTTGCTCAGAGGT Chr9:70305704..70305723 60.28 55
downstream ENSMUSE00000217780 Chr9:70301308..70301624 GGTGTGCTAATGCATGATGG Chr9:70301471..70301490 59.96 50
downstream ENSMUSE00000217807 Chr9:70298093..70298348 TAGTGCCGACATGACGAAAG Chr9:70298085..70298104 59.86 50
downstream ENSMUSE00000217804 Chr9:70291209..70291557 TGATGGTGCAGTGGTCTTGT Chr9:70291505..70291524 60.16 50
downstream ENSMUSE00000217791 Chr9:70290079..70290204 AAGACATGGTTTGAGGCACA Chr9:70290091..70290110 59.14 45
downstream ENSMUSE00000217782 Chr9:70288562..70288688 GCAGAGCACCAGGTGTGTAG Chr9:70288611..70288630 59.49 60
downstream ENSMUSE00000406268 Chr9:70279744..70279836 GTGAGGATAGCCTGCCATGT Chr9:70279788..70279807 60.1 55
downstream ENSMUSE00000217786 Chr9:70278738..70278833 GAGGCTCCACGATTGACATT Chr9:70278762..70278781 60.08 50
downstream ENSMUSE00000217795 Chr9:70277359..70277486 TGCAGTGCAGTTTCCTCTGT Chr9:70277425..70277444 59.62 50
downstream ENSMUSE00000696307 Chr9:70273237..70274914 GGGGCACTTCTTATTGGTGA Chr9:70274820..70274839 59.93 50
downstream ENSMUSE00000386215 Chr9:70273236..70274914 GGGGCACTTCTTATTGGTGA Chr9:70274820..70274839 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGAATGCAGCAGAAGTTG Chr9:70306819..70306839 59.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGAATGCAGCAGAAGTTG Chr9:70306819..70306839 59.75 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032217