Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4314
Trapped Gene
AK122525 (ENSMUSG00000038214)
Vector Insertion
Chr 10: 43233623 - 43233768
Public Clones AG0117 (sanger) XB424 (baygenomics) XB749 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000508545 (Chr10:43229653..43233622 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTAGGGCTCTTTTGCAGGTG Chr10:43233089..43233108 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000508545 (Chr10:43229653..43233622 +)
Downstram Exon
ENSMUSE00000511401 (Chr10:43233769..43235202 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTAGGGCTCTTTTGCAGGTG Chr10:43233089..43233108 60.01 55 ACGGCCACATGAATAAAAGC Chr10:43234566..43234585 59.97 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000496671 Chr10:43198946..43199178 CGCTCCGCAAAGTAACAACT Chr10:43199149..43199168 60.44 50
upstream ENSMUSE00000497694 Chr10:43213448..43213495 No primer for this exon
upstream ENSMUSE00000458897 Chr10:43213952..43214148 GACGCTACCTTGGACTGCTC Chr10:43213987..43214006 60.02 60
upstream ENSMUSE00000508545 Chr10:43229653..43233622 CTAGGGCTCTTTTGCAGGTG Chr10:43233089..43233108 60.01 55

*** Putative Vector Insertion (Chr 10: 43233623 - 43233768) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000511401 Chr10:43233769..43235202 ACGGCCACATGAATAAAAGC Chr10:43234566..43234585 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTGAGAAGTGCGCAGAGA Chr10:43233597..43233617 60.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTGAGAAGTGCGCAGAGA Chr10:43233597..43233617 60.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038214