Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4329
Trapped Gene
Clcc1 (ENSMUSG00000027884)
Vector Insertion
Chr 3: 108476346 - 108477554
Public Clones AF0834 (sanger) AF0617 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000173927 (Chr3:108476199..108476345 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGCTCATGAAGGAGATTC Chr3:108476276..108476295 59.54 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000173927 (Chr3:108476199..108476345 +)
Downstram Exon
ENSMUSE00000173925 (Chr3:108477555..108477881 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGCTCATGAAGGAGATTC Chr3:108476276..108476295 59.54 50 GGGCCCCTGTAAGAGAAATC Chr3:108477724..108477743 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670632 Chr3:108456831..108456898 No primer for this exon
upstream ENSMUSE00000670636 Chr3:108456876..108456969 GTGCACCGTGTTTGAGGTAG Chr3:108456883..108456902 59.21 55
upstream ENSMUSE00000670643 Chr3:108456908..108457263 CGATTCCCTGTTCCGTCTTA Chr3:108457064..108457083 60.07 50
upstream ENSMUSE00000636506 Chr3:108457165..108457263 CAAATACTGACGGCCAAAAA Chr3:108457210..108457229 58.67 40
upstream ENSMUSE00000490719 Chr3:108464273..108464413 GACGACTGGATTGACCCAAC Chr3:108464345..108464364 60.37 55
upstream ENSMUSE00000670641 Chr3:108464273..108464413 GACGACTGGATTGACCCAAC Chr3:108464345..108464364 60.37 55
upstream ENSMUSE00000173921 Chr3:108464850..108464951 GAAGCCGAGGAACTGTCAGA Chr3:108464898..108464917 60.53 55
upstream ENSMUSE00000173924 Chr3:108466442..108466549 No primer for this exon
upstream ENSMUSE00000173923 Chr3:108470881..108471102 GATGCGTTACGATGCTGAGA Chr3:108470901..108470920 59.98 50
upstream ENSMUSE00000358144 Chr3:108471617..108471757 TCGCTGGTACACACAGATGA Chr3:108471676..108471695 58.81 50
upstream ENSMUSE00000401545 Chr3:108473820..108473913 AGGCTAACATTGCTGGGATG Chr3:108473839..108473858 60.1 50
upstream ENSMUSE00000173928 Chr3:108475738..108475835 CCCTATTTGGTTGGTTCCAC Chr3:108475808..108475827 59.15 50
upstream ENSMUSE00000173927 Chr3:108476199..108476345 AGCGCTCATGAAGGAGATTC Chr3:108476276..108476295 59.54 50

*** Putative Vector Insertion (Chr 3: 108476346 - 108477554) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173925 Chr3:108477555..108477881 GGGCCCCTGTAAGAGAAATC Chr3:108477724..108477743 59.9 55
downstream ENSMUSE00000587544 Chr3:108479603..108480930 TCACGTCGTTCTGCAGGTAG Chr3:108480301..108480320 60.05 55
downstream ENSMUSE00000670633 Chr3:108479603..108480927 TCACGTCGTTCTGCAGGTAG Chr3:108480301..108480320 60.05 55
downstream ENSMUSE00000670635 Chr3:108479603..108479896 TATTCTGTCGGGGTGCTTTC Chr3:108479676..108479695 60.07 50
downstream ENSMUSE00000670631 Chr3:108481458..108481758 CTGGCCTTGATATCGTCACC Chr3:108481576..108481595 60.48 55
downstream ENSMUSE00000670634 Chr3:108481458..108481752 CTGGCCTTGATATCGTCACC Chr3:108481576..108481595 60.48 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACTGCTCACAGTGAATACG Chr3:108476359..108476380 59.53 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAGCGTGACTGGGAAAAC Chr3:108476392..108476412 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027884