Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI433
Trapped Gene
Siah1b (ENSMUSG00000040749)
Vector Insertion
Chr X: 160511283 - 160513509
Public Clones DD0495 (sanger) (ggtc) P124B03 (ggtc) D171E09 (ggtc) E025G12 (ggtc)
P124B03 (ggtc) D171E09 (ggtc) IST14417G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000238253 (ChrX:160513510..160513601 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATTAAGGGCTGGCTACTG ChrX:160513531..160513550 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000238253 (ChrX:160513510..160513601 -)
Downstram Exon
ENSMUSE00000238244 (ChrX:160511222..160511282 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATTAAGGGCTGGCTACTG ChrX:160513531..160513550 59.87 55 AAGGTTCCACATTCTTGGTCA ChrX:160511208..160511228 59.44 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000439238 ChrX:160514047..160514082 No primer for this exon
upstream ENSMUSE00000238260 ChrX:160513947..160513981 GGCCTTTACACGCACTGTCT ChrX:160513951..160513970 60.32 55
upstream ENSMUSE00000238253 ChrX:160513510..160513601 GCATTAAGGGCTGGCTACTG ChrX:160513531..160513550 59.87 55

*** Putative Vector Insertion (Chr X: 160511283 - 160513509) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238244 ChrX:160511222..160511282 AAGGTTCCACATTCTTGGTCA ChrX:160511208..160511228 59.44 42.86
downstream ENSMUSE00000462557 ChrX:160508637..160510159 TTCAGCTTGTTTGCGTGTTC ChrX:160509336..160509355 60.03 45
downstream ENSMUSE00000478735 ChrX:160508635..160510159 TTCAGCTTGTTTGCGTGTTC ChrX:160509336..160509355 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTAAGGGCTGGCTACTGG ChrX:160513528..160513548 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTAAGGGCTGGCTACTGG ChrX:160513528..160513548 59.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAGATCGAGAGACCAGGAA ChrX:160513584..160513604 60.34 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAGATCGAGAGACCAGGAA ChrX:160513584..160513604 60.34 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040749