Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4332
Trapped Gene
Cpsf6 (ENSMUSG00000055531)
Vector Insertion
Chr 10: 116793181 - 116796048
Public Clones AF0800 (sanger) P056F06 (ggtc) G013F01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459129 (Chr10:116796049..116796202 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGCCTTCATGGAATCGAG Chr10:116796075..116796094 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459129 (Chr10:116796049..116796202 -)
Downstram Exon
ENSMUSE00000459161 (Chr10:116792994..116793180 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGCCTTCATGGAATCGAG Chr10:116796075..116796094 60.04 45 TATGGCGACGACTCTTTTCC Chr10:116793100..116793119 60.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000573809 Chr10:116813895..116814029 AGACATTTACGCGGATGTGG Chr10:116813912..116813931 60.91 50
upstream ENSMUSE00000459168 Chr10:116804835..116805044 CTGGGAAGAGAATCGCATTG Chr10:116804856..116804875 60.73 50
upstream ENSMUSE00000459152 Chr10:116803137..116803240 GACCTAACTGAGGCCGTTCA Chr10:116803206..116803225 60.26 55
upstream ENSMUSE00000459150 Chr10:116800031..116800176 ATTTGCCCTTGTTGGTGTTG Chr10:116800157..116800176 60.79 45
upstream ENSMUSE00000459143 Chr10:116799070..116799243 AGCGTTTCCTCAAGGTGGTA Chr10:116799160..116799179 59.73 50
upstream ENSMUSE00000459138 Chr10:116797912..116798416 TTTCCTGGACAACCTTTTGG Chr10:116798257..116798276 59.94 45
upstream ENSMUSE00000459134 Chr10:116797496..116797611 GCTGTGTCTGACGCTAGTGC Chr10:116797498..116797517 59.81 60
upstream ENSMUSE00000459129 Chr10:116796049..116796202 ATTGCCTTCATGGAATCGAG Chr10:116796075..116796094 60.04 45

*** Putative Vector Insertion (Chr 10: 116793181 - 116796048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000459161 Chr10:116792994..116793180 TATGGCGACGACTCTTTTCC Chr10:116793100..116793119 60.21 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAAGTCCTATGGGTCTGGAT Chr10:116796051..116796072 60.2 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAAGTCCTATGGGTCTGGAT Chr10:116796051..116796072 60.2 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055531