Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4334
Trapped Gene
Zfp90 (ENSMUSG00000031907)
Vector Insertion
Chr 8: 108939671 - 108942970
Public Clones AF0734 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000390344 (Chr8:108939239..108939670 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACTGCCGGGAACAAGAAAC Chr8:108939293..108939312 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000390344 (Chr8:108939239..108939670 +)
Downstram Exon
ENSMUSE00000580226 (Chr8:108942971..108943097 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACTGCCGGGAACAAGAAAC Chr8:108939293..108939312 60.11 50 CGACACCAGGTGGTTGTAGTT Chr8:108943095..108943115 59.94 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000390344 Chr8:108939239..108939670 TACTGCCGGGAACAAGAAAC Chr8:108939293..108939312 60.11 50

*** Putative Vector Insertion (Chr 8: 108939671 - 108942970) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000580226 Chr8:108942971..108943097 CGACACCAGGTGGTTGTAGTT Chr8:108943095..108943115 59.94 52.38
downstream ENSMUSE00000214585 Chr8:108943415..108943510 GAAGATCACCTCTGGCTTGG Chr8:108943449..108943468 59.8 55
downstream ENSMUSE00000353560 Chr8:108947813..108949789 CCACAGAGATTGCAGCGATA Chr8:108948578..108948597 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAACGGGAGCTGTGATCTG Chr8:108942640..108942660 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACGGGAGCTGTGATCTG Chr8:108942640..108942660 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031907