Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI435
Trapped Gene
Pten (ENSMUSG00000013663)
Vector Insertion
Chr 19: 32850590 - 32867038
Public Clones DD0436 (sanger) AG0201 (sanger) AG0202 (sanger) IST10894D2 (tigm)
IST13571D3 (tigm) IST14649D11 (tigm)
Private Clones OST392897 (lexicon) OST389689 (lexicon) OST337983 (lexicon) OST310557 (lexicon)
OST309129 (lexicon) OST173488 (lexicon) OST38599 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000348178 (Chr19:32850505..32850589 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000348178 (Chr19:32850505..32850589 +)
Downstram Exon
ENSMUSE00000146019 (Chr19:32867039..32867083 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000545317 Chr19:32832089..32833013 No primer for this exon
upstream ENSMUSE00000348178 Chr19:32850505..32850589 No primer for this exon

*** Putative Vector Insertion (Chr 19: 32850590 - 32867038) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000146019 Chr19:32867039..32867083 No primer for this exon
downstream ENSMUSE00000146017 Chr19:32872561..32872604 No primer for this exon
downstream ENSMUSE00000146011 Chr19:32874351..32874589 No primer for this exon
downstream ENSMUSE00000146009 Chr19:32886186..32886327 No primer for this exon
downstream ENSMUSE00000146006 Chr19:32889907..32890073 No primer for this exon
downstream ENSMUSE00000146015 Chr19:32892326..32892550 No primer for this exon
downstream ENSMUSE00000620052 Chr19:32894333..32894554 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGTTAATCGCCTTGCAG Chr19:32865635..32865655 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCGTGACTGGGAAAACC Chr19:32865637..32865657 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013663