Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4362
Trapped Gene
Psmb1 (ENSMUSG00000014769)
Vector Insertion
Chr 17: 15627250 - 15630061
Public Clones AF0219 (sanger) (ggtc)
Private Clones OST257932 (lexicon) OST170352 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000135936 (Chr17:15630062..15630143 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000135936 (Chr17:15630062..15630143 -)
Downstram Exon
ENSMUSE00000135932 (Chr17:15627120..15627249 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000135934 Chr17:15635117..15635262 No primer for this exon
upstream ENSMUSE00000135935 Chr17:15631380..15631487 No primer for this exon
upstream ENSMUSE00000135936 Chr17:15630062..15630143 No primer for this exon

*** Putative Vector Insertion (Chr 17: 15627250 - 15630061) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000135932 Chr17:15627120..15627249 No primer for this exon
downstream ENSMUSE00000135931 Chr17:15614279..15614385 No primer for this exon
downstream ENSMUSE00000454699 Chr17:15612924..15613169 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCAACAATTCACAGCACA Chr17:15630013..15630033 59.88 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCAACAATTCACAGCACA Chr17:15630013..15630033 59.88 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014769