Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4367
Trapped Gene
Akap12 (ENSMUSG00000038587)
Vector Insertion
Chr 10: 5991351 - 5993400
Public Clones AF0116 (sanger) RRM026 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000577414 (Chr10:5991352..5993399 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAGCTGAAGCAATCCACA Chr10:5992999..5993018 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000577414 (Chr10:5991352..5993399 -)
Downstram Exon
ENSMUSE00000519058 (Chr10:5988602..5993399 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAGCTGAAGCAATCCACA Chr10:5992999..5993018 59.99 50 CCGCATCGTACTCAGACAGA Chr10:5991140..5991159 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000491803 Chr10:6079873..6080178 ACCCCTTAGTCCCTGTGGTC Chr10:6080107..6080126 60.23 60
upstream ENSMUSE00000490750 Chr10:6032684..6032798 AGATGTCCACGTCCAAGAGG Chr10:6032726..6032745 60.11 55
upstream ENSMUSE00000577414 Chr10:5991352..5993399 GTGAGCTGAAGCAATCCACA Chr10:5992999..5993018 59.99 50

*** Putative Vector Insertion (Chr 10: 5991351 - 5993400) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000577421 Chr10:5991159..5991350 CCGCATCGTACTCAGACAGA Chr10:5991140..5991159 60.01 55
downstream ENSMUSE00000519058 Chr10:5988602..5993399 CCGCATCGTACTCAGACAGA Chr10:5991140..5991159 60.01 55
downstream ENSMUSE00000515563 Chr10:5987073..5988063 TTTGGTCTCAAGGTCCCAAC Chr10:5987969..5987988 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000038587